EMAIL THIS PAGE TO A FRIEND

MPDZ

multiple PDZ domain protein

51 Gene Product Result for
Synonyms: HYC2 MUPP1
Gene ID:
Mouse(17475) multiple PDZ domain protein
Rat(29365) multiple PDZ domain protein
chicken(427360) multiple PDZ domain protein
dog(474708) multiple PDZ domain protein
domestic cat(101095690) multiple PDZ domain protein
cow(536863) multiple PDZ domain protein
Horse(100052067) multiple PDZ domain protein
naked mole-rat(101706793) multiple PDZ domain protein
Domestic Rabbit(100341484) multiple PDZ domain protein
domestic guinea pig(100716925) multiple PDZ domain protein
sheep(101120218) multiple PDZ domain protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003829 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003829 Rosetta Predictions human pricing
NM_019196 Rosetta Predictions rat pricing
NM_010820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025557 predicted 4906
2 SASI_Hs01_00025559 predicted 3061
3 SASI_Hs01_00025560 predicted 809
4 SASI_Hs02_00336384 predicted 3520
5 SASI_Hs01_00025561 predicted 4110
6 SASI_Hs02_00336385 predicted 4617
7 SASI_Hs01_00025562 predicted 2547
8 SASI_Hs01_00025564 predicted 5536
9 SASI_Hs02_00336386 predicted 4628
10 SASI_Hs02_00336387 predicted 1495
11 SASI_Hs01_00025558 predicted 913
12 SASI_Hs01_00025563 predicted 969
13 SASI_Hs01_00025565 predicted 3866
14 SASI_Hs01_00025566 predicted 4385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051084 predicted 1512
2 SASI_Rn01_00051086 predicted 4379
3 SASI_Rn01_00051087 predicted 1781
4 SASI_Rn01_00051089 predicted 5703
5 SASI_Rn02_00262014 predicted 2622
6 SASI_Rn01_00051090 predicted 6048
7 SASI_Rn02_00262015 predicted 905
8 SASI_Rn01_00051091 predicted 6042
9 SASI_Rn01_00051092 predicted 3374
10 SASI_Rn02_00262016 predicted 820
11 SASI_Rn01_00051085 predicted 1680
12 SASI_Rn01_00051088 predicted 953
13 SASI_Rn01_00051093 predicted 4651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140069 predicted 6093
2 SASI_Mm01_00140070 predicted 1733
3 SASI_Mm01_00140071 predicted 1825
4 SASI_Mm01_00140072 predicted 951
5 SASI_Mm01_00140073 predicted 2664
6 SASI_Mm01_00140074 predicted 6082
7 SASI_Mm01_00140075 predicted 1381
8 SASI_Mm01_00140076 predicted 5235
9 SASI_Mm01_00140077 predicted 3656
10 SASI_Mm01_00140078 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010820
VALIDATED
MPDZ MISSION shRNA Bacterial Glycerol Stock
multiple PDZ domain protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-1430s21c1
Sequence:CCGGGCCTTCAGGAATCTTTGTAAACTCGAGTTTACAAAGATTCCTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-6612s21c1
Sequence:CCGGTCTCGACAATATCTAACAATTCTCGAGAATTGTTAGATATTGTCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-3508s21c1
Sequence:CCGGGAATAATGGCACTGGATATTTCTCGAGAAATATCCAGTGCCATTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010820.2-5831s21c1
Sequence:CCGGGCTCGGAGATGTCCCTATATTCTCGAGAATATAGGGACATCTCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-5755s21c1
Sequence:CCGGGACTAAGAACAGTCGAAATAACTCGAGTTATTTCGACTGTTCTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-5607s1c1
Sequence:CCGGCATCTGAAATTCAGGGACTAACTCGAGTTAGTCCCTGAATTTCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-5606s1c1
Sequence:CCGGGCATCTGAAATTCAGGGACTACTCGAGTAGTCCCTGAATTTCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-1297s1c1
Sequence:CCGGGCCTTCAGGAATCTTTGTAAACTCGAGTTTACAAAGATTCCTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-4163s1c1
Sequence:CCGGCGCACCAGAATGAGTGTGTTTCTCGAGAAACACACTCATTCTGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-2546s1c1
Sequence:CCGGGCTCTGATAGATACACCTGATCTCGAGATCAGGTGTATCTATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010820
VALIDATED
MPDZ MISSION shRNA shRNA Plasmid DNA
multiple PDZ domain protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-1430s21c1
Sequence:CCGGGCCTTCAGGAATCTTTGTAAACTCGAGTTTACAAAGATTCCTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-6612s21c1
Sequence:CCGGTCTCGACAATATCTAACAATTCTCGAGAATTGTTAGATATTGTCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-3508s21c1
Sequence:CCGGGAATAATGGCACTGGATATTTCTCGAGAAATATCCAGTGCCATTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010820.2-5831s21c1
Sequence:CCGGGCTCGGAGATGTCCCTATATTCTCGAGAATATAGGGACATCTCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-5755s21c1
Sequence:CCGGGACTAAGAACAGTCGAAATAACTCGAGTTATTTCGACTGTTCTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-5607s1c1
Sequence:CCGGCATCTGAAATTCAGGGACTAACTCGAGTTAGTCCCTGAATTTCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-5606s1c1
Sequence:CCGGGCATCTGAAATTCAGGGACTACTCGAGTAGTCCCTGAATTTCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-1297s1c1
Sequence:CCGGGCCTTCAGGAATCTTTGTAAACTCGAGTTTACAAAGATTCCTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-4163s1c1
Sequence:CCGGCGCACCAGAATGAGTGTGTTTCTCGAGAAACACACTCATTCTGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-2546s1c1
Sequence:CCGGGCTCTGATAGATACACCTGATCTCGAGATCAGGTGTATCTATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010820
VALIDATED
MPDZ MISSION shRNA Lentiviral Transduction Particles
multiple PDZ domain protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-1430s21c1
Sequence:CCGGGCCTTCAGGAATCTTTGTAAACTCGAGTTTACAAAGATTCCTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-6612s21c1
Sequence:CCGGTCTCGACAATATCTAACAATTCTCGAGAATTGTTAGATATTGTCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-3508s21c1
Sequence:CCGGGAATAATGGCACTGGATATTTCTCGAGAAATATCCAGTGCCATTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010820.2-5831s21c1
Sequence:CCGGGCTCGGAGATGTCCCTATATTCTCGAGAATATAGGGACATCTCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010820.2-5755s21c1
Sequence:CCGGGACTAAGAACAGTCGAAATAACTCGAGTTATTTCGACTGTTCTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-5607s1c1
Sequence:CCGGCATCTGAAATTCAGGGACTAACTCGAGTTAGTCCCTGAATTTCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-5606s1c1
Sequence:CCGGGCATCTGAAATTCAGGGACTACTCGAGTAGTCCCTGAATTTCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-1297s1c1
Sequence:CCGGGCCTTCAGGAATCTTTGTAAACTCGAGTTTACAAAGATTCCTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-4163s1c1
Sequence:CCGGCGCACCAGAATGAGTGTGTTTCTCGAGAAACACACTCATTCTGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010820.1-2546s1c1
Sequence:CCGGGCTCTGATAGATACACCTGATCTCGAGATCAGGTGTATCTATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003829
VALIDATED
MPDZ MISSION shRNA Bacterial Glycerol Stock
multiple PDZ domain protein
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-3368s21c1
Sequence:CCGGGAAGAGTAATGGCACTGGATACTCGAGTATCCAGTGCCATTACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-5490s21c1
Sequence:CCGGGTCACTGGAAAGTAGCTCAAACTCGAGTTTGAGCTACTTTCCAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-1840s21c1
Sequence:CCGGGACGAGCTATTGGAAGTAAATCTCGAGATTTACTTCCAATAGCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-3816s21c1
Sequence:CCGGGCACAACCTTTACCCTAAGTACTCGAGTACTTAGGGTAAAGGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-5908s21c1
Sequence:CCGGCCTCCTCAATGTAAGTCTATTCTCGAGAATAGACTTACATTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003829.1-1835s1c1
Sequence:CCGGGACGAGCTATTGGAAGTAAATCTCGAGATTTACTTCCAATAGCTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-5906s1c1
Sequence:CCGGCCTCCTCAATGTAAGTCTATTCTCGAGAATAGACTTACATTGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003829.1-3811s1c1
Sequence:CCGGGCACAACCTTTACCCTAAGTACTCGAGTACTTAGGGTAAAGGTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-3363s1c1
Sequence:CCGGGAAGAGTAATGGCACTGGATACTCGAGTATCCAGTGCCATTACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-5488s1c1
Sequence:CCGGGTCACTGGAAAGTAGCTCAAACTCGAGTTTGAGCTACTTTCCAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003829.1-6330s1c1
Sequence:CCGGGCTTTCCTTACTGACAACCTACTCGAGTAGGTTGTCAGTAAGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003829.1-6183s1c1
Sequence:CCGGGCCAGAATTGAACCAACCCAACTCGAGTTGGGTTGGTTCAATTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003829.1-4431s1c1
Sequence:CCGGCAGAGCCAACTGTTACTACTTCTCGAGAAGTAGTAACAGTTGGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003829
VALIDATED
MPDZ MISSION shRNA shRNA Plasmid DNA
multiple PDZ domain protein
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-3368s21c1
Sequence:CCGGGAAGAGTAATGGCACTGGATACTCGAGTATCCAGTGCCATTACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-5490s21c1
Sequence:CCGGGTCACTGGAAAGTAGCTCAAACTCGAGTTTGAGCTACTTTCCAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-1840s21c1
Sequence:CCGGGACGAGCTATTGGAAGTAAATCTCGAGATTTACTTCCAATAGCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-3816s21c1
Sequence:CCGGGCACAACCTTTACCCTAAGTACTCGAGTACTTAGGGTAAAGGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-5908s21c1
Sequence:CCGGCCTCCTCAATGTAAGTCTATTCTCGAGAATAGACTTACATTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003829.1-1835s1c1
Sequence:CCGGGACGAGCTATTGGAAGTAAATCTCGAGATTTACTTCCAATAGCTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-5906s1c1
Sequence:CCGGCCTCCTCAATGTAAGTCTATTCTCGAGAATAGACTTACATTGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003829.1-3811s1c1
Sequence:CCGGGCACAACCTTTACCCTAAGTACTCGAGTACTTAGGGTAAAGGTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-3363s1c1
Sequence:CCGGGAAGAGTAATGGCACTGGATACTCGAGTATCCAGTGCCATTACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-5488s1c1
Sequence:CCGGGTCACTGGAAAGTAGCTCAAACTCGAGTTTGAGCTACTTTCCAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003829.1-6330s1c1
Sequence:CCGGGCTTTCCTTACTGACAACCTACTCGAGTAGGTTGTCAGTAAGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003829.1-6183s1c1
Sequence:CCGGGCCAGAATTGAACCAACCCAACTCGAGTTGGGTTGGTTCAATTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003829.1-4431s1c1
Sequence:CCGGCAGAGCCAACTGTTACTACTTCTCGAGAAGTAGTAACAGTTGGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003829
VALIDATED
MPDZ MISSION shRNA Lentiviral Transduction Particles
multiple PDZ domain protein
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-3368s21c1
Sequence:CCGGGAAGAGTAATGGCACTGGATACTCGAGTATCCAGTGCCATTACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-5490s21c1
Sequence:CCGGGTCACTGGAAAGTAGCTCAAACTCGAGTTTGAGCTACTTTCCAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-1840s21c1
Sequence:CCGGGACGAGCTATTGGAAGTAAATCTCGAGATTTACTTCCAATAGCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-3816s21c1
Sequence:CCGGGCACAACCTTTACCCTAAGTACTCGAGTACTTAGGGTAAAGGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003829.3-5908s21c1
Sequence:CCGGCCTCCTCAATGTAAGTCTATTCTCGAGAATAGACTTACATTGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003829.1-1835s1c1
Sequence:CCGGGACGAGCTATTGGAAGTAAATCTCGAGATTTACTTCCAATAGCTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-5906s1c1
Sequence:CCGGCCTCCTCAATGTAAGTCTATTCTCGAGAATAGACTTACATTGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003829.1-3811s1c1
Sequence:CCGGGCACAACCTTTACCCTAAGTACTCGAGTACTTAGGGTAAAGGTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-3363s1c1
Sequence:CCGGGAAGAGTAATGGCACTGGATACTCGAGTATCCAGTGCCATTACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003829.1-5488s1c1
Sequence:CCGGGTCACTGGAAAGTAGCTCAAACTCGAGTTTGAGCTACTTTCCAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003829.1-6330s1c1
Sequence:CCGGGCTTTCCTTACTGACAACCTACTCGAGTAGGTTGTCAGTAAGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003829.1-6183s1c1
Sequence:CCGGGCCAGAATTGAACCAACCCAACTCGAGTTGGGTTGGTTCAATTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003829.1-4431s1c1
Sequence:CCGGCAGAGCCAACTGTTACTACTTCTCGAGAAGTAGTAACAGTTGGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)