EMAIL THIS PAGE TO A FRIEND

MPG

N-methylpurine-DNA glycosylase

77 Gene Product Result for
Synonyms: AAG ADPG APNG CRA36.1 MDG Mid1 PIG11 PIG16 anpg
Gene ID:
Mouse(268395) N-methylpurine-DNA glycosylase
Rat(24561) N-methylpurine-DNA glycosylase
sheep(101120377) N-methylpurine-DNA glycosylase
naked mole-rat(101707491) N-methylpurine-DNA glycosylase
domestic guinea pig(100717139) N-methylpurine-DNA glycosylase
Zebrafish(566516) N-methylpurine-DNA glycosylase
domestic cat(101097777) N-methylpurine-DNA glycosylase
dog(611597) N-methylpurine-DNA glycosylase
cow(618306) N-methylpurine-DNA glycosylase
chicken(416648) N-methylpurine-DNA glycosylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015052 Rosetta Predictions human pricing
NM_001015054 Rosetta Predictions human pricing
NM_002434 Rosetta Predictions human pricing
NM_012601 Rosetta Predictions rat pricing
NM_010822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075712 predicted 589
2 SASI_Hs01_00075713 predicted 450
3 SASI_Hs01_00075714 predicted 449
4 SASI_Hs01_00075715 predicted 613
5 SASI_Hs01_00075716 predicted 686
6 SASI_Hs01_00075718 predicted 436
7 SASI_Hs01_00075719 predicted 726
8 SASI_Hs01_00075720 predicted 439
9 SASI_Hs01_00075721 predicted 588
10 SASI_Hs02_00306641 predicted 433
11 SASI_Hs01_00075717 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168092 predicted 528
2 SASI_Hs01_00168093 predicted 390
3 SASI_Hs01_00168094 predicted 395
4 SASI_Hs01_00168095 predicted 553
5 SASI_Hs01_00168096 predicted 629
6 SASI_Hs01_00168098 predicted 382
7 SASI_Hs01_00168099 predicted 668
8 SASI_Hs01_00168100 predicted 374
9 SASI_Hs01_00168101 predicted 523
10 SASI_Hs02_00306643 predicted 378
11 SASI_Hs01_00168097 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123529 predicted 777
2 SASI_Hs01_00123530 predicted 635
3 SASI_Hs01_00123531 predicted 645
4 SASI_Hs01_00123532 predicted 805
5 SASI_Hs01_00123533 predicted 883
6 SASI_Hs01_00123535 predicted 631
7 SASI_Hs01_00123536 predicted 913
8 SASI_Hs01_00123537 predicted 633
9 SASI_Hs01_00123538 predicted 772
10 SASI_Hs02_00333834 predicted 634
11 SASI_Hs01_00123534 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078639 predicted 540
2 SASI_Rn01_00078640 predicted 556
3 SASI_Rn01_00078641 predicted 339
4 SASI_Rn01_00078642 predicted 635
5 SASI_Rn02_00259760 predicted 691
6 SASI_Rn01_00078643 predicted 512
7 SASI_Rn01_00078644 predicted 481
8 SASI_Rn01_00078645 predicted 617
9 SASI_Rn02_00259761 predicted 727
10 SASI_Rn02_00259762 predicted 517
11 SASI_Rn01_00078646 predicted 724
12 SASI_Rn01_00078647 predicted 691
13 SASI_Rn01_00078648 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023367 predicted 1055
2 SASI_Mm02_00319434 predicted 469
3 SASI_Mm01_00023368 predicted 872
4 SASI_Mm01_00023369 predicted 1192
5 SASI_Mm01_00023370 predicted 574
6 SASI_Mm01_00023371 predicted 1131
7 SASI_Mm01_00023373 predicted 297
8 SASI_Mm01_00023374 predicted 862
9 SASI_Mm01_00023376 predicted 1091
10 SASI_Mm02_00319435 predicted 551
11 SASI_Mm01_00023372 predicted 909
12 SASI_Mm01_00023375 predicted 955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002434
MPG MISSION shRNA Bacterial Glycerol Stock
N-methylpurine-DNA glycosylase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-621s21c1
Sequence:CCGGATTTCTGGGACAGGTCCTAGTCTCGAGACTAGGACCTGTCCCAGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-577s21c1
Sequence:CCGGGGGTTGGAGTTCTTCGACCAGCTCGAGCTGGTCGAAGAACTCCAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-1032s21c1
Sequence:CCGGGGATGAAGCTGTATGGCTGGACTCGAGTCCAGCCATACAGCTTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-474s1c1
Sequence:CCGGCGACTTCCTAATGGCACAGAACTCGAGTTCTGTGCCATTAGGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-611s1c1
Sequence:CCGGCCTGTACGTGTACATCATTTACTCGAGTAAATGATGTACACGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-353s1c1
Sequence:CCGGCCCATACCGCAGCATCTATTTCTCGAGAAATAGATGCTGCGGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-620s1c1
Sequence:CCGGGTACATCATTTACGGCATGTACTCGAGTACATGCCGTAAATGATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-365s1c1
Sequence:CCGGCATCTATTTCTCAAGCCCAAACTCGAGTTTGGGCTTGAGAAATAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002434
MPG MISSION shRNA shRNA Plasmid DNA
N-methylpurine-DNA glycosylase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-621s21c1
Sequence:CCGGATTTCTGGGACAGGTCCTAGTCTCGAGACTAGGACCTGTCCCAGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-577s21c1
Sequence:CCGGGGGTTGGAGTTCTTCGACCAGCTCGAGCTGGTCGAAGAACTCCAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-1032s21c1
Sequence:CCGGGGATGAAGCTGTATGGCTGGACTCGAGTCCAGCCATACAGCTTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-474s1c1
Sequence:CCGGCGACTTCCTAATGGCACAGAACTCGAGTTCTGTGCCATTAGGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-611s1c1
Sequence:CCGGCCTGTACGTGTACATCATTTACTCGAGTAAATGATGTACACGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-353s1c1
Sequence:CCGGCCCATACCGCAGCATCTATTTCTCGAGAAATAGATGCTGCGGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-620s1c1
Sequence:CCGGGTACATCATTTACGGCATGTACTCGAGTACATGCCGTAAATGATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-365s1c1
Sequence:CCGGCATCTATTTCTCAAGCCCAAACTCGAGTTTGGGCTTGAGAAATAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002434
MPG MISSION shRNA Lentiviral Transduction Particles
N-methylpurine-DNA glycosylase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-621s21c1
Sequence:CCGGATTTCTGGGACAGGTCCTAGTCTCGAGACTAGGACCTGTCCCAGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-577s21c1
Sequence:CCGGGGGTTGGAGTTCTTCGACCAGCTCGAGCTGGTCGAAGAACTCCAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002434.2-1032s21c1
Sequence:CCGGGGATGAAGCTGTATGGCTGGACTCGAGTCCAGCCATACAGCTTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-474s1c1
Sequence:CCGGCGACTTCCTAATGGCACAGAACTCGAGTTCTGTGCCATTAGGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-611s1c1
Sequence:CCGGCCTGTACGTGTACATCATTTACTCGAGTAAATGATGTACACGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-353s1c1
Sequence:CCGGCCCATACCGCAGCATCTATTTCTCGAGAAATAGATGCTGCGGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-620s1c1
Sequence:CCGGGTACATCATTTACGGCATGTACTCGAGTACATGCCGTAAATGATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002434.1-365s1c1
Sequence:CCGGCATCTATTTCTCAAGCCCAAACTCGAGTTTGGGCTTGAGAAATAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010822
VALIDATED
MPG MISSION shRNA Bacterial Glycerol Stock
N-methylpurine-DNA glycosylase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010822.2-160s21c1
Sequence:CCGGGGATCCCTAGTGACCGGATATCTCGAGATATCCGGTCACTAGGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010822.2-871s21c1
Sequence:CCGGGCCCGTATAGGTATTGGTCATCTCGAGATGACCAATACCTATACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010822.2-1157s21c1
Sequence:CCGGACATCAACGTGCAGGTGTATACTCGAGTATACACCTGCACGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010822.2-589s21c1
Sequence:CCGGTGCTTGAATGTCTCTAGTCAACTCGAGTTGACTAGAGACATTCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010822.2-527s21c1
Sequence:CCGGACCGTGGCATGTTCATGAAACCTCGAGGTTTCATGAACATGCCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-1062s1c1
Sequence:CCGGCCCAAGTCTCAGCCAGAATTTCTCGAGAAATTCTGGCTGAGACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010822.2-208s1c1
Sequence:CCGGCTTTCCCGAAAGATTGGGCAACTCGAGTTGCCCAATCTTTCGGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-589s1c1
Sequence:CCGGTGCTTGAATGTCTCTAGTCAACTCGAGTTGACTAGAGACATTCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-871s1c1
Sequence:CCGGGCCCGTATAGGTATTGGTCATCTCGAGATGACCAATACCTATACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-555s1c1
Sequence:CCGGCCTGTATGTGTACCTCATCTACTCGAGTAGATGAGGTACACATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010822
VALIDATED
MPG MISSION shRNA shRNA Plasmid DNA
N-methylpurine-DNA glycosylase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010822.2-160s21c1
Sequence:CCGGGGATCCCTAGTGACCGGATATCTCGAGATATCCGGTCACTAGGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010822.2-871s21c1
Sequence:CCGGGCCCGTATAGGTATTGGTCATCTCGAGATGACCAATACCTATACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010822.2-1157s21c1
Sequence:CCGGACATCAACGTGCAGGTGTATACTCGAGTATACACCTGCACGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010822.2-589s21c1
Sequence:CCGGTGCTTGAATGTCTCTAGTCAACTCGAGTTGACTAGAGACATTCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010822.2-527s21c1
Sequence:CCGGACCGTGGCATGTTCATGAAACCTCGAGGTTTCATGAACATGCCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-1062s1c1
Sequence:CCGGCCCAAGTCTCAGCCAGAATTTCTCGAGAAATTCTGGCTGAGACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010822.2-208s1c1
Sequence:CCGGCTTTCCCGAAAGATTGGGCAACTCGAGTTGCCCAATCTTTCGGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-589s1c1
Sequence:CCGGTGCTTGAATGTCTCTAGTCAACTCGAGTTGACTAGAGACATTCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-871s1c1
Sequence:CCGGGCCCGTATAGGTATTGGTCATCTCGAGATGACCAATACCTATACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-555s1c1
Sequence:CCGGCCTGTATGTGTACCTCATCTACTCGAGTAGATGAGGTACACATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010822
VALIDATED
MPG MISSION shRNA Lentiviral Transduction Particles
N-methylpurine-DNA glycosylase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010822.2-160s21c1
Sequence:CCGGGGATCCCTAGTGACCGGATATCTCGAGATATCCGGTCACTAGGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010822.2-871s21c1
Sequence:CCGGGCCCGTATAGGTATTGGTCATCTCGAGATGACCAATACCTATACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010822.2-1157s21c1
Sequence:CCGGACATCAACGTGCAGGTGTATACTCGAGTATACACCTGCACGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010822.2-589s21c1
Sequence:CCGGTGCTTGAATGTCTCTAGTCAACTCGAGTTGACTAGAGACATTCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010822.2-527s21c1
Sequence:CCGGACCGTGGCATGTTCATGAAACCTCGAGGTTTCATGAACATGCCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-1062s1c1
Sequence:CCGGCCCAAGTCTCAGCCAGAATTTCTCGAGAAATTCTGGCTGAGACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010822.2-208s1c1
Sequence:CCGGCTTTCCCGAAAGATTGGGCAACTCGAGTTGCCCAATCTTTCGGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-589s1c1
Sequence:CCGGTGCTTGAATGTCTCTAGTCAACTCGAGTTGACTAGAGACATTCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-871s1c1
Sequence:CCGGGCCCGTATAGGTATTGGTCATCTCGAGATGACCAATACCTATACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010822.2-555s1c1
Sequence:CCGGCCTGTATGTGTACCTCATCTACTCGAGTAGATGAGGTACACATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)