EMAIL THIS PAGE TO A FRIEND

MPHOSPH10

M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)

58 Gene Product Result for
Synonyms: CT90 MPP10 MPP10P
UniProtKB ID: O00566, A0AVJ8
Gene ID:
Human(10199) Summary: This gene encodes a protein that is phosphorylated during mitosis. The protein localizes to the nucleolus during interphase and to the chromosomes during M phase. The protein associates with the U3 small nucleolar ribonucleoprotein 60-80S complexes and may be involved in pre-rRNA processing. [provided by RefSeq, Dec 2010]
Mouse(67973) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Rat(293828) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
domestic guinea pig(100715911) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
naked mole-rat(101724332) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Zebrafish(323426) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
cow(531149) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Horse(100050492) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
dog(612775) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
chicken(415384) M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005791 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005791 Rosetta Predictions human pricing
NM_001106340 Rosetta Predictions rat pricing
NM_026483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203952 predicted 811
2 SASI_Hs01_00203953 predicted 628
3 SASI_Hs01_00203960 predicted 573
4 SASI_Hs01_00203955 predicted 760
5 SASI_Hs02_00340288 predicted 624
6 SASI_Hs01_00203958 predicted 935
7 SASI_Hs01_00203959 predicted 1719
8 SASI_Hs02_00340289 predicted 618
9 SASI_Hs01_00203951 predicted 767
10 SASI_Hs01_00203956 predicted 644
11 SASI_Hs01_00203954 predicted 1138
12 SASI_Hs01_00203957 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218008 predicted 221
2 SASI_Rn02_00218009 predicted 1027
3 SASI_Rn02_00218010 predicted 1438
4 SASI_Rn02_00218011 predicted 1370
5 SASI_Rn02_00218012 predicted 602
6 SASI_Rn02_00218013 predicted 512
7 SASI_Rn02_00218014 predicted 1608
8 SASI_Rn02_00218015 predicted 258
9 SASI_Rn02_00218016 predicted 1932
10 SASI_Rn02_00218017 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190042 predicted 1036
2 SASI_Mm01_00190043 predicted 339
3 SASI_Mm01_00190044 predicted 1382
4 SASI_Mm01_00190045 predicted 999
5 SASI_Mm01_00190046 predicted 320
6 SASI_Mm01_00190047 predicted 211
7 SASI_Mm02_00330354 predicted 1039
8 SASI_Mm01_00190048 predicted 1949
9 SASI_Mm02_00330355 predicted 297
10 SASI_Mm01_00190049 predicted 1014
11 SASI_Mm01_00190041 predicted 221
12 SASI_Mm01_00190050 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026483
MPHOSPH10 MISSION shRNA Bacterial Glycerol Stock
M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-888s1c1
Sequence:CCGGCCTTAAAGTCATCTCAGGCATCTCGAGATGCCTGAGATGACTTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-466s1c1
Sequence:CCGGGAAGATGATGGATTCTCTCTTCTCGAGAAGAGAGAATCCATCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-554s1c1
Sequence:CCGGGTATCGAATCTGCCAGCCATACTCGAGTATGGCTGGCAGATTCGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-351s1c1
Sequence:CCGGCCTTAGACCATGAGAAGAGTACTCGAGTACTCTTCTCATGGTCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026483
MPHOSPH10 MISSION shRNA shRNA Plasmid DNA
M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-888s1c1
Sequence:CCGGCCTTAAAGTCATCTCAGGCATCTCGAGATGCCTGAGATGACTTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-466s1c1
Sequence:CCGGGAAGATGATGGATTCTCTCTTCTCGAGAAGAGAGAATCCATCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-554s1c1
Sequence:CCGGGTATCGAATCTGCCAGCCATACTCGAGTATGGCTGGCAGATTCGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-351s1c1
Sequence:CCGGCCTTAGACCATGAGAAGAGTACTCGAGTACTCTTCTCATGGTCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026483
MPHOSPH10 MISSION shRNA Lentiviral Transduction Particles
M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-888s1c1
Sequence:CCGGCCTTAAAGTCATCTCAGGCATCTCGAGATGCCTGAGATGACTTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-466s1c1
Sequence:CCGGGAAGATGATGGATTCTCTCTTCTCGAGAAGAGAGAATCCATCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-554s1c1
Sequence:CCGGGTATCGAATCTGCCAGCCATACTCGAGTATGGCTGGCAGATTCGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026483.1-351s1c1
Sequence:CCGGCCTTAGACCATGAGAAGAGTACTCGAGTACTCTTCTCATGGTCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005791
VALIDATED
MPHOSPH10 MISSION shRNA Bacterial Glycerol Stock
M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1592s1c1
Sequence:CCGGGCACCTGTGATTACAGAGGAACTCGAGTTCCTCTGTAATCACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005791.1-628s1c1
Sequence:CCGGGAATGCAGTTAGTGAAACAATCTCGAGATTGTTTCACTAACTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1211s1c1
Sequence:CCGGCTGGATTCAAACAAAGAAGATCTCGAGATCTTCTTTGTTTGAATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1729s1c1
Sequence:CCGGCTTAGACCATGAGAAGAGTAACTCGAGTTACTCTTCTCATGGTCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-2190s1c1
Sequence:CCGGCAGTAGCTTCGGAGAAGTTAACTCGAGTTAACTTCTCCGAAGCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-725s1c1
Sequence:CCGGGATGACAAGGAGGACCTAGAACTCGAGTTCTAGGTCCTCCTTGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-1211s21c1
Sequence:CCGGCTGGATTCAAACAAAGAAGATCTCGAGATCTTCTTTGTTTGAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-725s21c1
Sequence:CCGGGATGACAAGGAGGACCTAGAACTCGAGTTCTAGGTCCTCCTTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-2190s21c1
Sequence:CCGGCAGTAGCTTCGGAGAAGTTAACTCGAGTTAACTTCTCCGAAGCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005791.1-1592s21c1
Sequence:CCGGGCACCTGTGATTACAGAGGAACTCGAGTTCCTCTGTAATCACAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005791
VALIDATED
MPHOSPH10 MISSION shRNA shRNA Plasmid DNA
M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1592s1c1
Sequence:CCGGGCACCTGTGATTACAGAGGAACTCGAGTTCCTCTGTAATCACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005791.1-628s1c1
Sequence:CCGGGAATGCAGTTAGTGAAACAATCTCGAGATTGTTTCACTAACTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1211s1c1
Sequence:CCGGCTGGATTCAAACAAAGAAGATCTCGAGATCTTCTTTGTTTGAATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1729s1c1
Sequence:CCGGCTTAGACCATGAGAAGAGTAACTCGAGTTACTCTTCTCATGGTCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-2190s1c1
Sequence:CCGGCAGTAGCTTCGGAGAAGTTAACTCGAGTTAACTTCTCCGAAGCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-725s1c1
Sequence:CCGGGATGACAAGGAGGACCTAGAACTCGAGTTCTAGGTCCTCCTTGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-1211s21c1
Sequence:CCGGCTGGATTCAAACAAAGAAGATCTCGAGATCTTCTTTGTTTGAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-725s21c1
Sequence:CCGGGATGACAAGGAGGACCTAGAACTCGAGTTCTAGGTCCTCCTTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-2190s21c1
Sequence:CCGGCAGTAGCTTCGGAGAAGTTAACTCGAGTTAACTTCTCCGAAGCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005791.1-1592s21c1
Sequence:CCGGGCACCTGTGATTACAGAGGAACTCGAGTTCCTCTGTAATCACAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005791
VALIDATED
MPHOSPH10 MISSION shRNA Lentiviral Transduction Particles
M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1592s1c1
Sequence:CCGGGCACCTGTGATTACAGAGGAACTCGAGTTCCTCTGTAATCACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005791.1-628s1c1
Sequence:CCGGGAATGCAGTTAGTGAAACAATCTCGAGATTGTTTCACTAACTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1211s1c1
Sequence:CCGGCTGGATTCAAACAAAGAAGATCTCGAGATCTTCTTTGTTTGAATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-1729s1c1
Sequence:CCGGCTTAGACCATGAGAAGAGTAACTCGAGTTACTCTTCTCATGGTCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-2190s1c1
Sequence:CCGGCAGTAGCTTCGGAGAAGTTAACTCGAGTTAACTTCTCCGAAGCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005791.1-725s1c1
Sequence:CCGGGATGACAAGGAGGACCTAGAACTCGAGTTCTAGGTCCTCCTTGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-1211s21c1
Sequence:CCGGCTGGATTCAAACAAAGAAGATCTCGAGATCTTCTTTGTTTGAATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-725s21c1
Sequence:CCGGGATGACAAGGAGGACCTAGAACTCGAGTTCTAGGTCCTCCTTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005791.1-2190s21c1
Sequence:CCGGCAGTAGCTTCGGAGAAGTTAACTCGAGTTAACTTCTCCGAAGCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005791.1-1592s21c1
Sequence:CCGGGCACCTGTGATTACAGAGGAACTCGAGTTCCTCTGTAATCACAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)