EMAIL THIS PAGE TO A FRIEND

MPHOSPH6

M-phase phosphoprotein 6

73 Gene Product Result for
Synonyms: MPP MPP-6 MPP6
UniProtKB ID: Q99547, B2RAF0
Gene ID:
Mouse(68533) M phase phosphoprotein 6
Rat(686999) M phase phosphoprotein 6
Zebrafish(445224) M-phase phosphoprotein 6
cow(512508) M-phase phosphoprotein 6
dog(479632) M-phase phosphoprotein 6
domestic cat(101081430) M-phase phosphoprotein 6
chicken(415811) M-phase phosphoprotein 6
naked mole-rat(101718979) M-phase phosphoprotein 6
domestic guinea pig(100730672) M-phase phosphoprotein 6
sheep(101122807) M-phase phosphoprotein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005792 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005792 Rosetta Predictions human pricing
NM_001129881 Rosetta Predictions rat pricing
NM_026758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155881 predicted 521
2 SASI_Hs01_00155882 predicted 266
3 SASI_Hs01_00155883 predicted 220
4 SASI_Hs01_00155884 predicted 438
5 SASI_Hs01_00155886 predicted 232
6 SASI_Hs02_00340290 predicted 200
7 SASI_Hs02_00340291 predicted 439
8 SASI_Hs01_00155887 predicted 357
9 SASI_Hs01_00155888 predicted 315
10 SASI_Hs02_00340292 predicted 478
11 SASI_Hs01_00155880 predicted 273
12 SASI_Hs01_00155885 predicted 460
13 SASI_Hs01_00155889 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255239 predicted 775
2 SASI_Rn02_00255240 predicted 638
3 SASI_Rn02_00255241 predicted 716
4 SASI_Rn02_00255242 predicted 616
5 SASI_Rn02_00255243 predicted 765
6 SASI_Rn02_00255244 predicted 792
7 SASI_Rn02_00255245 predicted 669
8 SASI_Rn02_00255246 predicted 743
9 SASI_Rn02_00255247 predicted 629
10 SASI_Rn02_00255248 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150080 predicted 270
2 SASI_Mm01_00150082 predicted 798
3 SASI_Mm02_00330809 predicted 822
4 SASI_Mm02_00330810 predicted 564
5 SASI_Mm01_00150084 predicted 740
6 SASI_Mm01_00150085 predicted 643
7 SASI_Mm01_00150086 predicted 750
8 SASI_Mm01_00150087 predicted 572
9 SASI_Mm02_00330811 predicted 588
10 SASI_Mm01_00150088 predicted 317
11 SASI_Mm01_00150081 predicted 555
12 SASI_Mm01_00150083 predicted 435
13 SASI_Mm01_00150089 predicted 774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026758
VALIDATED
MPHOSPH6 MISSION shRNA Bacterial Glycerol Stock
M-phase phosphoprotein 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-433s21c1
Sequence:CCGGCGAGCCAATTACGAAGAAGATCTCGAGATCTTCTTCGTAATTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-291s21c1
Sequence:CCGGGCTTCAGATGAATTCTAAGAACTCGAGTTCTTAGAATTCATCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026758.3-826s21c1
Sequence:CCGGGCCTTTGTTTAACTGCCCTTACTCGAGTAAGGGCAGTTAAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-351s21c1
Sequence:CCGGCGATGTGTCTGATGAGGAAATCTCGAGATTTCCTCATCAGACACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-434s1c1
Sequence:CCGGCGAGCCAATTACGAAGAAGATCTCGAGATCTTCTTCGTAATTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-381s1c1
Sequence:CCGGGATATGAGACTTTGGTGGGAACTCGAGTTCCCACCAAAGTCTCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-292s1c1
Sequence:CCGGGCTTCAGATGAATTCTAAGAACTCGAGTTCTTAGAATTCATCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-352s1c1
Sequence:CCGGCGATGTGTCTGATGAGGAAATCTCGAGATTTCCTCATCAGACACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-380s21c1
Sequence:CCGGGATATGAGACTTTGGTGGGAACTCGAGTTCCCACCAAAGTCTCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026758.1-830s1c1
Sequence:CCGGGCCTTTGTTTAACTGCCCTTACTCGAGTAAGGGCAGTTAAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026758
VALIDATED
MPHOSPH6 MISSION shRNA shRNA Plasmid DNA
M-phase phosphoprotein 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-433s21c1
Sequence:CCGGCGAGCCAATTACGAAGAAGATCTCGAGATCTTCTTCGTAATTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-291s21c1
Sequence:CCGGGCTTCAGATGAATTCTAAGAACTCGAGTTCTTAGAATTCATCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026758.3-826s21c1
Sequence:CCGGGCCTTTGTTTAACTGCCCTTACTCGAGTAAGGGCAGTTAAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-351s21c1
Sequence:CCGGCGATGTGTCTGATGAGGAAATCTCGAGATTTCCTCATCAGACACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-434s1c1
Sequence:CCGGCGAGCCAATTACGAAGAAGATCTCGAGATCTTCTTCGTAATTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-381s1c1
Sequence:CCGGGATATGAGACTTTGGTGGGAACTCGAGTTCCCACCAAAGTCTCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-292s1c1
Sequence:CCGGGCTTCAGATGAATTCTAAGAACTCGAGTTCTTAGAATTCATCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-352s1c1
Sequence:CCGGCGATGTGTCTGATGAGGAAATCTCGAGATTTCCTCATCAGACACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-380s21c1
Sequence:CCGGGATATGAGACTTTGGTGGGAACTCGAGTTCCCACCAAAGTCTCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026758.1-830s1c1
Sequence:CCGGGCCTTTGTTTAACTGCCCTTACTCGAGTAAGGGCAGTTAAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026758
VALIDATED
MPHOSPH6 MISSION shRNA Lentiviral Transduction Particles
M-phase phosphoprotein 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-433s21c1
Sequence:CCGGCGAGCCAATTACGAAGAAGATCTCGAGATCTTCTTCGTAATTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-291s21c1
Sequence:CCGGGCTTCAGATGAATTCTAAGAACTCGAGTTCTTAGAATTCATCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026758.3-826s21c1
Sequence:CCGGGCCTTTGTTTAACTGCCCTTACTCGAGTAAGGGCAGTTAAACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-351s21c1
Sequence:CCGGCGATGTGTCTGATGAGGAAATCTCGAGATTTCCTCATCAGACACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-434s1c1
Sequence:CCGGCGAGCCAATTACGAAGAAGATCTCGAGATCTTCTTCGTAATTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-381s1c1
Sequence:CCGGGATATGAGACTTTGGTGGGAACTCGAGTTCCCACCAAAGTCTCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-292s1c1
Sequence:CCGGGCTTCAGATGAATTCTAAGAACTCGAGTTCTTAGAATTCATCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026758.1-352s1c1
Sequence:CCGGCGATGTGTCTGATGAGGAAATCTCGAGATTTCCTCATCAGACACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026758.3-380s21c1
Sequence:CCGGGATATGAGACTTTGGTGGGAACTCGAGTTCCCACCAAAGTCTCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026758.1-830s1c1
Sequence:CCGGGCCTTTGTTTAACTGCCCTTACTCGAGTAAGGGCAGTTAAACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005792
VALIDATED
MPHOSPH6 MISSION shRNA Bacterial Glycerol Stock
M-phase phosphoprotein 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-366s1c1
Sequence:CCGGGAAGAGATGGCTAGAAGATATCTCGAGATATCTTCTAGCCATCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-348s1c1
Sequence:CCGGGAGCTTGATGTGTCAGATGAACTCGAGTTCATCTGACACATCAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-293s1c1
Sequence:CCGGGATGCTTCAGATGAATGCTAACTCGAGTTAGCATTCATCTGAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005792.1-345s1c1
Sequence:CCGGGTAGAGCTTGATGTGTCAGATCTCGAGATCTGACACATCAAGCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-336s1c1
Sequence:CCGGGATGAAACAGTAGAGCTTGATCTCGAGATCAAGCTCTACTGTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-300s1c1
Sequence:CCGGCAGATGAATGCTAAGCACAAACTCGAGTTTGTGCTTAGCATTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005792.1-845s1c1
Sequence:CCGGGCCAATGTTTAAATTGCCCTTCTCGAGAAGGGCAATTTAAACATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-416s1c1
Sequence:CCGGGTTTGCCAGAAAGAGAGACCACTCGAGTGGTCTCTCTTTCTGGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-321s1c1
Sequence:CCGGGCAGAAGAAGTTGAAGATGAACTCGAGTTCATCTTCAACTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-176s1c1
Sequence:CCGGGCCAGAGCTTAAAGAGAAAGACTCGAGTCTTTCTCTTTAAGCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005792
VALIDATED
MPHOSPH6 MISSION shRNA shRNA Plasmid DNA
M-phase phosphoprotein 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-366s1c1
Sequence:CCGGGAAGAGATGGCTAGAAGATATCTCGAGATATCTTCTAGCCATCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-348s1c1
Sequence:CCGGGAGCTTGATGTGTCAGATGAACTCGAGTTCATCTGACACATCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-293s1c1
Sequence:CCGGGATGCTTCAGATGAATGCTAACTCGAGTTAGCATTCATCTGAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005792.1-345s1c1
Sequence:CCGGGTAGAGCTTGATGTGTCAGATCTCGAGATCTGACACATCAAGCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-336s1c1
Sequence:CCGGGATGAAACAGTAGAGCTTGATCTCGAGATCAAGCTCTACTGTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-300s1c1
Sequence:CCGGCAGATGAATGCTAAGCACAAACTCGAGTTTGTGCTTAGCATTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005792.1-845s1c1
Sequence:CCGGGCCAATGTTTAAATTGCCCTTCTCGAGAAGGGCAATTTAAACATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-416s1c1
Sequence:CCGGGTTTGCCAGAAAGAGAGACCACTCGAGTGGTCTCTCTTTCTGGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-321s1c1
Sequence:CCGGGCAGAAGAAGTTGAAGATGAACTCGAGTTCATCTTCAACTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-176s1c1
Sequence:CCGGGCCAGAGCTTAAAGAGAAAGACTCGAGTCTTTCTCTTTAAGCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005792
VALIDATED
MPHOSPH6 MISSION shRNA Lentiviral Transduction Particles
M-phase phosphoprotein 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-366s1c1
Sequence:CCGGGAAGAGATGGCTAGAAGATATCTCGAGATATCTTCTAGCCATCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-348s1c1
Sequence:CCGGGAGCTTGATGTGTCAGATGAACTCGAGTTCATCTGACACATCAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-293s1c1
Sequence:CCGGGATGCTTCAGATGAATGCTAACTCGAGTTAGCATTCATCTGAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005792.1-345s1c1
Sequence:CCGGGTAGAGCTTGATGTGTCAGATCTCGAGATCTGACACATCAAGCTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-336s1c1
Sequence:CCGGGATGAAACAGTAGAGCTTGATCTCGAGATCAAGCTCTACTGTTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-300s1c1
Sequence:CCGGCAGATGAATGCTAAGCACAAACTCGAGTTTGTGCTTAGCATTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005792.1-845s1c1
Sequence:CCGGGCCAATGTTTAAATTGCCCTTCTCGAGAAGGGCAATTTAAACATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-416s1c1
Sequence:CCGGGTTTGCCAGAAAGAGAGACCACTCGAGTGGTCTCTCTTTCTGGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-321s1c1
Sequence:CCGGGCAGAAGAAGTTGAAGATGAACTCGAGTTCATCTTCAACTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005792.1-176s1c1
Sequence:CCGGGCCAGAGCTTAAAGAGAAAGACTCGAGTCTTTCTCTTTAAGCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)