EMAIL THIS PAGE TO A FRIEND

MPHOSPH8

M-phase phosphoprotein 8

51 Gene Product Result for
Synonyms: HSMPP8 TWA3 mpp8
Gene ID:
Mouse(75339) M-phase phosphoprotein 8
Rat(290270) M-phase phosphoprotein 8
domestic guinea pig(100713225) M-phase phosphoprotein 8
naked mole-rat(101699502) M-phase phosphoprotein 8
sheep(101119484) M-phase phosphoprotein 8
Zebrafish(504061) M-phase phosphoprotein 8
chicken(418957) M-phase phosphoprotein 8
cow(507091) M-phase phosphoprotein 8
Horse(100053303) M-phase phosphoprotein 8
domestic cat(101081515) M-phase phosphoprotein 8
dog(100271920) M-phase phosphoprotein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017520 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017520 Rosetta Predictions human pricing
NM_001017375 Rosetta Predictions rat pricing
NM_023773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214368 predicted 1404
2 SASI_Hs01_00214369 predicted 2606
3 SASI_Hs01_00214370 predicted 1050
4 SASI_Hs01_00214371 predicted 2045
5 SASI_Hs01_00214372 predicted 1478
6 SASI_Hs01_00214373 predicted 2296
7 SASI_Hs01_00214374 predicted 2167
8 SASI_Hs02_00350143 predicted 2043
9 SASI_Hs01_00214376 predicted 1705
10 SASI_Hs01_00214377 predicted 1387
11 SASI_Hs01_00214375 predicted 2639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202202 predicted 2091
2 SASI_Rn02_00202203 predicted 2107
3 SASI_Rn02_00202204 predicted 1661
4 SASI_Rn02_00202205 predicted 2093
5 SASI_Rn02_00202206 predicted 2062
6 SASI_Rn02_00202207 predicted 2260
7 SASI_Rn02_00202208 predicted 2534
8 SASI_Rn02_00202209 predicted 2083
9 SASI_Rn02_00202210 predicted 2195
10 SASI_Rn02_00202211 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065879 predicted 2221
2 SASI_Mm01_00065880 predicted 2466
3 SASI_Mm01_00065881 predicted 314
4 SASI_Mm01_00065883 predicted 1759
5 SASI_Mm02_00327342 predicted 2496
6 SASI_Mm01_00065884 predicted 1839
7 SASI_Mm01_00065885 predicted 2481
8 SASI_Mm01_00065887 predicted 334
9 SASI_Mm01_00065888 predicted 2230
10 SASI_Mm02_00327343 predicted 2005
11 SASI_Mm01_00065882 predicted 1782
12 SASI_Mm01_00065886 predicted 2208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017520
MPHOSPH8 MISSION shRNA Bacterial Glycerol Stock
M-phase phosphoprotein 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017520.2-2700s1c1
Sequence:CCGGCCTCTTGCAGTTAAGCCTGTTCTCGAGAACAGGCTTAACTGCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-2422s1c1
Sequence:CCGGCAAGCTGTAGTTCTGAATGATCTCGAGATCATTCAGAACTACAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-1047s1c1
Sequence:CCGGGCTAGAGAACAAGAACGCTTTCTCGAGAAAGCGTTCTTGTTCTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-2352s1c1
Sequence:CCGGGCTGTTTATCTTCCATGCAAACTCGAGTTTGCATGGAAGATAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-315s1c1
Sequence:CCGGGCTTCTTGAATTTAGGAAGAACTCGAGTTCTTCCTAAATTCAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017520.2-2784s21c1
Sequence:CCGGCAGTGTCCAGACTGCGTATTTCTCGAGAAATACGCAGTCTGGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-2126s21c1
Sequence:CCGGTTGCGAAGCAGTCTAACAATGCTCGAGCATTGTTAGACTGCTTCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-102s21c1
Sequence:CCGGTGGAGTAGTGGGCGAAGATAACTCGAGTTATCTTCGCCCACTACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-2050s21c1
Sequence:CCGGGACATCGTACGACTCGTAATTCTCGAGAATTACGAGTCGTACGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017520
MPHOSPH8 MISSION shRNA shRNA Plasmid DNA
M-phase phosphoprotein 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017520.2-2700s1c1
Sequence:CCGGCCTCTTGCAGTTAAGCCTGTTCTCGAGAACAGGCTTAACTGCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-2422s1c1
Sequence:CCGGCAAGCTGTAGTTCTGAATGATCTCGAGATCATTCAGAACTACAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-1047s1c1
Sequence:CCGGGCTAGAGAACAAGAACGCTTTCTCGAGAAAGCGTTCTTGTTCTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-2352s1c1
Sequence:CCGGGCTGTTTATCTTCCATGCAAACTCGAGTTTGCATGGAAGATAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-315s1c1
Sequence:CCGGGCTTCTTGAATTTAGGAAGAACTCGAGTTCTTCCTAAATTCAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017520.2-2784s21c1
Sequence:CCGGCAGTGTCCAGACTGCGTATTTCTCGAGAAATACGCAGTCTGGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-2126s21c1
Sequence:CCGGTTGCGAAGCAGTCTAACAATGCTCGAGCATTGTTAGACTGCTTCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-102s21c1
Sequence:CCGGTGGAGTAGTGGGCGAAGATAACTCGAGTTATCTTCGCCCACTACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-2050s21c1
Sequence:CCGGGACATCGTACGACTCGTAATTCTCGAGAATTACGAGTCGTACGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017520
MPHOSPH8 MISSION shRNA Lentiviral Transduction Particles
M-phase phosphoprotein 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017520.2-2700s1c1
Sequence:CCGGCCTCTTGCAGTTAAGCCTGTTCTCGAGAACAGGCTTAACTGCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-2422s1c1
Sequence:CCGGCAAGCTGTAGTTCTGAATGATCTCGAGATCATTCAGAACTACAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-1047s1c1
Sequence:CCGGGCTAGAGAACAAGAACGCTTTCTCGAGAAAGCGTTCTTGTTCTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-2352s1c1
Sequence:CCGGGCTGTTTATCTTCCATGCAAACTCGAGTTTGCATGGAAGATAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017520.2-315s1c1
Sequence:CCGGGCTTCTTGAATTTAGGAAGAACTCGAGTTCTTCCTAAATTCAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017520.2-2784s21c1
Sequence:CCGGCAGTGTCCAGACTGCGTATTTCTCGAGAAATACGCAGTCTGGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-2126s21c1
Sequence:CCGGTTGCGAAGCAGTCTAACAATGCTCGAGCATTGTTAGACTGCTTCGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-102s21c1
Sequence:CCGGTGGAGTAGTGGGCGAAGATAACTCGAGTTATCTTCGCCCACTACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017520.2-2050s21c1
Sequence:CCGGGACATCGTACGACTCGTAATTCTCGAGAATTACGAGTCGTACGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023773
MPHOSPH8 MISSION shRNA Bacterial Glycerol Stock
M-phase phosphoprotein 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023773.1-2772s1c1
Sequence:CCGGCCTACCTAGTTGTAAACTTAACTCGAGTTAAGTTTACAACTAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-2376s1c1
Sequence:CCGGGCCGGATTTCTCAACAGATTTCTCGAGAAATCTGTTGAGAAATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-311s1c1
Sequence:CCGGGCGAGGGAGGTAAGAATCTTTCTCGAGAAAGATTCTTACCTCCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-669s1c1
Sequence:CCGGCACCTCTGAAATAATCGGTTTCTCGAGAAACCGATTATTTCAGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-2635s1c1
Sequence:CCGGGCCAAGGTTAAGTTGCTAATACTCGAGTATTAGCAACTTAACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-668s21c1
Sequence:CCGGCACCTCTGAAATAATCGGTTTCTCGAGAAACCGATTATTTCAGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-2375s21c1
Sequence:CCGGGCCGGATTTCTCAACAGATTTCTCGAGAAATCTGTTGAGAAATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-2634s21c1
Sequence:CCGGGCCAAGGTTAAGTTGCTAATACTCGAGTATTAGCAACTTAACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-310s21c1
Sequence:CCGGGCGAGGGAGGTAAGAATCTTTCTCGAGAAAGATTCTTACCTCCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023773
MPHOSPH8 MISSION shRNA shRNA Plasmid DNA
M-phase phosphoprotein 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023773.1-2772s1c1
Sequence:CCGGCCTACCTAGTTGTAAACTTAACTCGAGTTAAGTTTACAACTAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-2376s1c1
Sequence:CCGGGCCGGATTTCTCAACAGATTTCTCGAGAAATCTGTTGAGAAATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-311s1c1
Sequence:CCGGGCGAGGGAGGTAAGAATCTTTCTCGAGAAAGATTCTTACCTCCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-669s1c1
Sequence:CCGGCACCTCTGAAATAATCGGTTTCTCGAGAAACCGATTATTTCAGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-2635s1c1
Sequence:CCGGGCCAAGGTTAAGTTGCTAATACTCGAGTATTAGCAACTTAACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-668s21c1
Sequence:CCGGCACCTCTGAAATAATCGGTTTCTCGAGAAACCGATTATTTCAGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-2375s21c1
Sequence:CCGGGCCGGATTTCTCAACAGATTTCTCGAGAAATCTGTTGAGAAATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-2634s21c1
Sequence:CCGGGCCAAGGTTAAGTTGCTAATACTCGAGTATTAGCAACTTAACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-310s21c1
Sequence:CCGGGCGAGGGAGGTAAGAATCTTTCTCGAGAAAGATTCTTACCTCCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023773
MPHOSPH8 MISSION shRNA Lentiviral Transduction Particles
M-phase phosphoprotein 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023773.1-2772s1c1
Sequence:CCGGCCTACCTAGTTGTAAACTTAACTCGAGTTAAGTTTACAACTAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-2376s1c1
Sequence:CCGGGCCGGATTTCTCAACAGATTTCTCGAGAAATCTGTTGAGAAATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-311s1c1
Sequence:CCGGGCGAGGGAGGTAAGAATCTTTCTCGAGAAAGATTCTTACCTCCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-669s1c1
Sequence:CCGGCACCTCTGAAATAATCGGTTTCTCGAGAAACCGATTATTTCAGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023773.1-2635s1c1
Sequence:CCGGGCCAAGGTTAAGTTGCTAATACTCGAGTATTAGCAACTTAACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-668s21c1
Sequence:CCGGCACCTCTGAAATAATCGGTTTCTCGAGAAACCGATTATTTCAGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-2375s21c1
Sequence:CCGGGCCGGATTTCTCAACAGATTTCTCGAGAAATCTGTTGAGAAATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-2634s21c1
Sequence:CCGGGCCAAGGTTAAGTTGCTAATACTCGAGTATTAGCAACTTAACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023773.2-310s21c1
Sequence:CCGGGCGAGGGAGGTAAGAATCTTTCTCGAGAAAGATTCTTACCTCCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)