EMAIL THIS PAGE TO A FRIEND

MPHOSPH9

M-phase phosphoprotein 9

170 Gene Product Result for
Synonyms: MPP-9 MPP9
UniProtKB ID: Q99550, A1L486, A6NEE2, B3KR87, Q9H976
Gene ID:
Mouse(269702) M-phase phosphoprotein 9
Rat(288654) M-phase phosphoprotein 9
chicken(416829) M-phase phosphoprotein 9
cow(530962) M-phase phosphoprotein 9
Horse(100060711) M-phase phosphoprotein 9
domestic cat(101089967) M-phase phosphoprotein 9
dog(477453) M-phase phosphoprotein 9
sheep(101118475) M-phase phosphoprotein 9
naked mole-rat(101721216) M-phase phosphoprotein 9
domestic guinea pig(100735243) M-phase phosphoprotein 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_194241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022782 Rosetta Predictions human pricing
XM_001079100 Rosetta Predictions rat pricing
XM_213773 Rosetta Predictions rat pricing
NM_001081323 Rosetta Predictions mouse pricing
XM_194241 Rosetta Predictions mouse pricing
XM_893274 Rosetta Predictions mouse pricing
XM_900724 Rosetta Predictions mouse pricing
XM_900730 Rosetta Predictions mouse pricing
XM_900739 Rosetta Predictions mouse pricing
XM_900747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149574 predicted 633
2 SASI_Hs02_00356080 predicted 1930
3 SASI_Hs01_00149576 predicted 1956
4 SASI_Hs01_00149577 predicted 2710
5 SASI_Hs01_00149578 predicted 1281
6 SASI_Hs01_00149579 predicted 1464
7 SASI_Hs01_00149581 predicted 1021
8 SASI_Hs01_00149582 predicted 1614
9 SASI_Hs01_00149583 predicted 2808
10 SASI_Hs02_00356081 predicted 738
11 SASI_Hs01_00149575 predicted 2591
12 SASI_Hs01_00149580 predicted 3040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363157 predicted 2383
2 SASI_Rn02_00363158 predicted 1859
3 SASI_Rn02_00363159 predicted 712
4 SASI_Rn02_00363160 predicted 3502
5 SASI_Rn02_00363161 predicted 3941
6 SASI_Rn02_00363162 predicted 3898
7 SASI_Rn02_00363163 predicted 2615
8 SASI_Rn02_00363164 predicted 1996
9 SASI_Rn02_00363165 predicted 1226
10 SASI_Rn02_00363166 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374906 predicted 2384
2 SASI_Rn02_00374907 predicted 1857
3 SASI_Rn02_00374908 predicted 709
4 SASI_Rn02_00374909 predicted 3510
5 SASI_Rn02_00374910 predicted 3934
6 SASI_Rn02_00374911 predicted 3900
7 SASI_Rn02_00374912 predicted 3843
8 SASI_Rn02_00374913 predicted 1995
9 SASI_Rn02_00374914 predicted 1225
10 SASI_Rn02_00374915 predicted 2190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297291 predicted 2634
2 SASI_Mm02_00297292 predicted 1647
3 SASI_Mm02_00297293 predicted 2862
4 SASI_Mm02_00297294 predicted 4153
5 SASI_Mm02_00297295 predicted 1981
6 SASI_Mm02_00297296 predicted 3360
7 SASI_Mm02_00297297 predicted 4168
8 SASI_Mm02_00297298 predicted 3318
9 SASI_Mm02_00297299 predicted 2243
10 SASI_Mm02_00297300 predicted 2338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264861 predicted 1993
2 SASI_Mm01_00264862 predicted 1004
3 SASI_Mm01_00264863 predicted 2213
4 SASI_Mm01_00264864 predicted 3523
5 SASI_Mm01_00264865 predicted 1348
6 SASI_Mm01_00264866 predicted 2719
7 SASI_Mm01_00264867 predicted 3534
8 SASI_Mm01_00264868 predicted 1598
9 SASI_Mm01_00264869 predicted 2055
10 SASI_Mm01_00264870 predicted 2372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285727 predicted 2640
2 SASI_Mm01_00285728 predicted 1648
3 SASI_Mm01_00285729 predicted 2866
4 SASI_Mm01_00285730 predicted 4160
5 SASI_Mm01_00285731 predicted 1987
6 SASI_Mm01_00285732 predicted 3370
7 SASI_Mm01_00285733 predicted 4179
8 SASI_Mm01_00285734 predicted 2252
9 SASI_Mm01_00285735 predicted 2700
10 SASI_Mm01_00285736 predicted 3024
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232325 predicted 860
2 SASI_Mm01_00232326 predicted 1092
3 SASI_Mm01_00232327 predicted 1008
4 SASI_Mm01_00232328 predicted 914
5 SASI_Mm01_00232329 predicted 955
6 SASI_Mm01_00232330 predicted 1063
7 SASI_Mm01_00232331 predicted 1010
8 SASI_Mm01_00232332 predicted 917
9 SASI_Mm01_00232333 predicted 1069
10 SASI_Mm01_00232334 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217706 predicted 1007
2 SASI_Mm01_00217707 predicted 1349
3 SASI_Mm01_00217708 predicted 1149
4 SASI_Mm01_00217709 predicted 849
5 SASI_Mm01_00217710 predicted 1225
6 SASI_Mm01_00217711 predicted 1542
7 SASI_Mm01_00217712 predicted 1093
8 SASI_Mm01_00217713 predicted 1607
9 SASI_Mm01_00217714 predicted 453
10 SASI_Mm01_00217715 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248509 predicted 428
2 SASI_Mm01_00248510 predicted 1128
3 SASI_Mm01_00248511 predicted 1561
4 SASI_Mm01_00248512 predicted 1458
5 SASI_Mm01_00248513 predicted 1029
6 SASI_Mm01_00248514 predicted 1471
7 SASI_Mm01_00248515 predicted 1142
8 SASI_Mm01_00248516 predicted 1371
9 SASI_Mm01_00248517 predicted 958
10 SASI_Mm01_00248518 predicted 1590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247853 predicted 275
2 SASI_Mm01_00247854 predicted 593
3 SASI_Mm01_00247855 predicted 414
4 SASI_Mm01_00247856 predicted 320
5 SASI_Mm01_00247857 predicted 364
6 SASI_Mm01_00247858 predicted 468
7 SASI_Mm01_00247859 predicted 412
8 SASI_Mm01_00247860 predicted 325
9 SASI_Mm01_00247861 predicted 838
10 SASI_Mm01_00247862 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022782
MPHOSPH9 MISSION shRNA Bacterial Glycerol Stock
M-phase phosphoprotein 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022782.2-3387s1c1
Sequence:CCGGGCTCAGGAATCTCTTGTATATCTCGAGATATACAAGAGATTCCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-3160s1c1
Sequence:CCGGCGCTAAAGAAATTCCATGTTTCTCGAGAAACATGGAATTTCTTTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022782.2-139s21c1
Sequence:CCGGATGAATCTGTTATCCATTATCCTCGAGGATAATGGATAACAGATTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-1482s1c1
Sequence:CCGGCGAGCTTATTATGAATCAGAACTCGAGTTCTGATTCATAATAAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-2805s1c1
Sequence:CCGGGCCACCGATAACCATGTTAATCTCGAGATTAACATGGTTATCGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-453s1c1
Sequence:CCGGCCTGGTGAATTTGAACATAATCTCGAGATTATGTTCAAATTCACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022782
MPHOSPH9 MISSION shRNA shRNA Plasmid DNA
M-phase phosphoprotein 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022782.2-3387s1c1
Sequence:CCGGGCTCAGGAATCTCTTGTATATCTCGAGATATACAAGAGATTCCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-3160s1c1
Sequence:CCGGCGCTAAAGAAATTCCATGTTTCTCGAGAAACATGGAATTTCTTTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022782.2-139s21c1
Sequence:CCGGATGAATCTGTTATCCATTATCCTCGAGGATAATGGATAACAGATTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-1482s1c1
Sequence:CCGGCGAGCTTATTATGAATCAGAACTCGAGTTCTGATTCATAATAAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-2805s1c1
Sequence:CCGGGCCACCGATAACCATGTTAATCTCGAGATTAACATGGTTATCGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-453s1c1
Sequence:CCGGCCTGGTGAATTTGAACATAATCTCGAGATTATGTTCAAATTCACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022782
MPHOSPH9 MISSION shRNA Lentiviral Transduction Particles
M-phase phosphoprotein 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022782.2-3387s1c1
Sequence:CCGGGCTCAGGAATCTCTTGTATATCTCGAGATATACAAGAGATTCCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-3160s1c1
Sequence:CCGGCGCTAAAGAAATTCCATGTTTCTCGAGAAACATGGAATTTCTTTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022782.2-139s21c1
Sequence:CCGGATGAATCTGTTATCCATTATCCTCGAGGATAATGGATAACAGATTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-1482s1c1
Sequence:CCGGCGAGCTTATTATGAATCAGAACTCGAGTTCTGATTCATAATAAGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-2805s1c1
Sequence:CCGGGCCACCGATAACCATGTTAATCTCGAGATTAACATGGTTATCGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022782.2-453s1c1
Sequence:CCGGCCTGGTGAATTTGAACATAATCTCGAGATTATGTTCAAATTCACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194241
MPHOSPH9 MISSION shRNA Bacterial Glycerol Stock
M-phase phosphoprotein 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-2352s1c1
Sequence:CCGGCGGGCGAGTAAAGGATACATTCTCGAGAATGTATCCTTTACTCGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194241.5-6912s1c1
Sequence:CCGGCCAGACATAAATATGGACTTACTCGAGTAAGTCCATATTTATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-1909s1c1
Sequence:CCGGGCTTATTATGAGTCGGAGATACTCGAGTATCTCCGACTCATAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-2755s1c1
Sequence:CCGGCCACCGATCATCAAGGCTTTACTCGAGTAAAGCCTTGATGATCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-3535s1c1
Sequence:CCGGGCCTTGGAAGATCGTTTGGAACTCGAGTTCCAAACGATCTTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194241
MPHOSPH9 MISSION shRNA shRNA Plasmid DNA
M-phase phosphoprotein 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-2352s1c1
Sequence:CCGGCGGGCGAGTAAAGGATACATTCTCGAGAATGTATCCTTTACTCGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194241.5-6912s1c1
Sequence:CCGGCCAGACATAAATATGGACTTACTCGAGTAAGTCCATATTTATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-1909s1c1
Sequence:CCGGGCTTATTATGAGTCGGAGATACTCGAGTATCTCCGACTCATAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-2755s1c1
Sequence:CCGGCCACCGATCATCAAGGCTTTACTCGAGTAAAGCCTTGATGATCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-3535s1c1
Sequence:CCGGGCCTTGGAAGATCGTTTGGAACTCGAGTTCCAAACGATCTTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194241
MPHOSPH9 MISSION shRNA Lentiviral Transduction Particles
M-phase phosphoprotein 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-2352s1c1
Sequence:CCGGCGGGCGAGTAAAGGATACATTCTCGAGAATGTATCCTTTACTCGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194241.5-6912s1c1
Sequence:CCGGCCAGACATAAATATGGACTTACTCGAGTAAGTCCATATTTATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-1909s1c1
Sequence:CCGGGCTTATTATGAGTCGGAGATACTCGAGTATCTCCGACTCATAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-2755s1c1
Sequence:CCGGCCACCGATCATCAAGGCTTTACTCGAGTAAAGCCTTGATGATCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194241.5-3535s1c1
Sequence:CCGGGCCTTGGAAGATCGTTTGGAACTCGAGTTCCAAACGATCTTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)