EMAIL THIS PAGE TO A FRIEND

MPI

mannose phosphate isomerase

109 Gene Product Result for
Synonyms: CDG1B PMI PMI1
UniProtKB ID: P34949, A8K8K9, Q96AB0
Gene ID:
Human(4351) Summary: Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. [provided by RefSeq, Jul 2008]
Mouse(110119) mannose phosphate isomerase
Rat(300741) mannose phosphate isomerase (mapped)
domestic guinea pig(100713995) mannose phosphate isomerase
naked mole-rat(101711803) mannose phosphate isomerase
Domestic Rabbit(100346668) mannose phosphate isomerase
sheep(101107901) mannose phosphate isomerase
Zebrafish(613246) mannose phosphate isomerase
domestic cat(101082316) mannose phosphate isomerase
cow(513586) mannose phosphate isomerase
Horse(100062077) mannose phosphate isomerase
chicken(769765) mannose phosphate isomerase
dog(478369) mannose phosphate isomerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002435 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002435 Rosetta Predictions human pricing
NM_001004081 Rosetta Predictions rat pricing
NM_025837 Rosetta Predictions mouse pricing
XM_134931 Rosetta Predictions mouse pricing
XM_896679 Rosetta Predictions mouse pricing
XM_896688 Rosetta Predictions mouse pricing
XM_896714 Rosetta Predictions mouse pricing
XM_896727 Rosetta Predictions mouse pricing
XM_896736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125121 predicted 919
2 SASI_Hs01_00125122 predicted 1196
3 SASI_Hs01_00125123 predicted 682
4 SASI_Hs01_00125124 predicted 1131
5 SASI_Hs01_00125125 predicted 1489
6 SASI_Hs02_00333835 predicted 965
7 SASI_Hs01_00125126 predicted 1379
8 SASI_Hs01_00125127 predicted 464
9 SASI_Hs01_00125128 predicted 1543
10 SASI_Hs01_00125129 predicted 808
11 SASI_Hs01_00125130 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034008 predicted 641
2 SASI_Rn01_00034009 predicted 670
3 SASI_Rn01_00034010 predicted 211
4 SASI_Rn01_00034011 predicted 904
5 SASI_Rn01_00034012 predicted 361
6 SASI_Rn01_00034014 predicted 750
7 SASI_Rn01_00034015 predicted 263
8 SASI_Rn01_00034016 predicted 472
9 SASI_Rn01_00034017 predicted 416
10 SASI_Rn02_00198109 predicted 1039
11 SASI_Rn01_00034013 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199331 predicted 831
2 SASI_Mm01_00199332 predicted 1094
3 SASI_Mm01_00199333 predicted 364
4 SASI_Mm01_00199334 predicted 235
5 SASI_Mm01_00199335 predicted 724
6 SASI_Mm01_00199336 predicted 1225
7 SASI_Mm01_00199337 predicted 1060
8 SASI_Mm01_00199338 predicted 1394
9 SASI_Mm01_00199339 predicted 931
10 SASI_Mm01_00199340 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237446 predicted 840
2 SASI_Mm01_00237447 predicted 1116
3 SASI_Mm01_00237448 predicted 381
4 SASI_Mm01_00237449 predicted 252
5 SASI_Mm01_00237450 predicted 743
6 SASI_Mm01_00237451 predicted 1238
7 SASI_Mm01_00237452 predicted 1068
8 SASI_Mm01_00237453 predicted 1403
9 SASI_Mm01_00237454 predicted 947
10 SASI_Mm01_00237455 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226969 predicted 385
2 SASI_Mm01_00226970 predicted 249
3 SASI_Mm01_00226971 predicted 216
4 SASI_Mm01_00226972 predicted 402
5 SASI_Mm01_00226973 predicted 239
6 SASI_Mm01_00226974 predicted 429
7 SASI_Mm01_00226975 predicted 461
8 SASI_Mm01_00226976 predicted 367
9 SASI_Mm01_00226977 predicted 418
10 SASI_Mm01_00226978 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244149 predicted 512
2 SASI_Mm01_00244150 predicted 543
3 SASI_Mm01_00244151 predicted 488
4 SASI_Mm01_00244152 predicted 462
5 SASI_Mm01_00244153 predicted 494
6 SASI_Mm01_00244154 predicted 562
7 SASI_Mm01_00244155 predicted 599
8 SASI_Mm01_00244156 predicted 751
9 SASI_Mm01_00244157 predicted 407
10 SASI_Mm01_00244158 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257888 predicted 531
2 SASI_Mm01_00257889 predicted 758
3 SASI_Mm01_00257890 predicted 248
4 SASI_Mm01_00257891 predicted 696
5 SASI_Mm01_00257892 predicted 211
6 SASI_Mm01_00257893 predicted 727
7 SASI_Mm01_00257894 predicted 235
8 SASI_Mm01_00257895 predicted 360
9 SASI_Mm01_00257896 predicted 706
10 SASI_Mm01_00257897 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224553 predicted 1438
2 SASI_Mm01_00224554 predicted 1495
3 SASI_Mm01_00224555 predicted 1419
4 SASI_Mm01_00224556 predicted 1393
5 SASI_Mm01_00224557 predicted 1269
6 SASI_Mm01_00224558 predicted 1293
7 SASI_Mm01_00224559 predicted 1451
8 SASI_Mm01_00224560 predicted 1368
9 SASI_Mm01_00224561 predicted 1275
10 SASI_Mm01_00224562 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204281 predicted 1481
2 SASI_Mm01_00204282 predicted 1107
3 SASI_Mm01_00204283 predicted 1061
4 SASI_Mm01_00204284 predicted 1433
5 SASI_Mm01_00204285 predicted 1535
6 SASI_Mm01_00204286 predicted 1306
7 SASI_Mm01_00204287 predicted 1156
8 SASI_Mm01_00204288 predicted 1257
9 SASI_Mm01_00204289 predicted 1418
10 SASI_Mm01_00204290 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002435
VALIDATED
MPI MISSION shRNA Bacterial Glycerol Stock
mannose phosphate isomerase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-123s21c1
Sequence:CCGGATCGCAGAGGACAAGCCTTATCTCGAGATAAGGCTTGTCCTCTGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-461s21c1
Sequence:CCGGGCCAGTTGAGGAGATTGTAACCTCGAGGTTACAATCTCCTCAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-1070s1c1
Sequence:CCGGTGTCACTGAATACAAGGTCTTCTCGAGAAGACCTTGTATTCAGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1029s21c1
Sequence:CCGGGTACCAGACTTCACCATTATGCTCGAGCATAATGGTGAAGTCTGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-255s1c1
Sequence:CCGGTCAAAGGTCAAGGACACCTTTCTCGAGAAAGGTGTCCTTGACCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002435.1-1026s1c1
Sequence:CCGGCCTGTACCAGACTTCACCATTCTCGAGAATGGTGAAGTCTGGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-683s1c1
Sequence:CCGGCGGAAACAACATGGAGGACATCTCGAGATGTCCTCCATGTTGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-468s1c1
Sequence:CCGGGAGGAGATTGTAACCTTTCTACTCGAGTAGAAAGGTTACAATCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-329s21c1
Sequence:CCGGCATCCAGGCACACCCTAACAACTCGAGTTGTTAGGGTGTGCCTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-299s21c1
Sequence:CCGGCAAAGTGCTCTCAGTTGAAACCTCGAGGTTTCAACTGAGAGCACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-929s21c1
Sequence:CCGGGTGTGAAATGCTCAGCTATACCTCGAGGTATAGCTGAGCATTTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1568s21c1
Sequence:CCGGGGCTTTAGGCTAGCTGTTAAACTCGAGTTTAACAGCTAGCCTAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1236s21c1
Sequence:CCGGCCGAAGGACCTGCTGATATTCCTCGAGGAATATCAGCAGGTCCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002435
VALIDATED
MPI MISSION shRNA shRNA Plasmid DNA
mannose phosphate isomerase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-123s21c1
Sequence:CCGGATCGCAGAGGACAAGCCTTATCTCGAGATAAGGCTTGTCCTCTGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-461s21c1
Sequence:CCGGGCCAGTTGAGGAGATTGTAACCTCGAGGTTACAATCTCCTCAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-1070s1c1
Sequence:CCGGTGTCACTGAATACAAGGTCTTCTCGAGAAGACCTTGTATTCAGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1029s21c1
Sequence:CCGGGTACCAGACTTCACCATTATGCTCGAGCATAATGGTGAAGTCTGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-255s1c1
Sequence:CCGGTCAAAGGTCAAGGACACCTTTCTCGAGAAAGGTGTCCTTGACCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002435.1-1026s1c1
Sequence:CCGGCCTGTACCAGACTTCACCATTCTCGAGAATGGTGAAGTCTGGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-683s1c1
Sequence:CCGGCGGAAACAACATGGAGGACATCTCGAGATGTCCTCCATGTTGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-468s1c1
Sequence:CCGGGAGGAGATTGTAACCTTTCTACTCGAGTAGAAAGGTTACAATCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-329s21c1
Sequence:CCGGCATCCAGGCACACCCTAACAACTCGAGTTGTTAGGGTGTGCCTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-299s21c1
Sequence:CCGGCAAAGTGCTCTCAGTTGAAACCTCGAGGTTTCAACTGAGAGCACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-929s21c1
Sequence:CCGGGTGTGAAATGCTCAGCTATACCTCGAGGTATAGCTGAGCATTTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1568s21c1
Sequence:CCGGGGCTTTAGGCTAGCTGTTAAACTCGAGTTTAACAGCTAGCCTAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1236s21c1
Sequence:CCGGCCGAAGGACCTGCTGATATTCCTCGAGGAATATCAGCAGGTCCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002435
VALIDATED
MPI MISSION shRNA Lentiviral Transduction Particles
mannose phosphate isomerase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-123s21c1
Sequence:CCGGATCGCAGAGGACAAGCCTTATCTCGAGATAAGGCTTGTCCTCTGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-461s21c1
Sequence:CCGGGCCAGTTGAGGAGATTGTAACCTCGAGGTTACAATCTCCTCAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-1070s1c1
Sequence:CCGGTGTCACTGAATACAAGGTCTTCTCGAGAAGACCTTGTATTCAGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1029s21c1
Sequence:CCGGGTACCAGACTTCACCATTATGCTCGAGCATAATGGTGAAGTCTGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-255s1c1
Sequence:CCGGTCAAAGGTCAAGGACACCTTTCTCGAGAAAGGTGTCCTTGACCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002435.1-1026s1c1
Sequence:CCGGCCTGTACCAGACTTCACCATTCTCGAGAATGGTGAAGTCTGGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-683s1c1
Sequence:CCGGCGGAAACAACATGGAGGACATCTCGAGATGTCCTCCATGTTGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002435.1-468s1c1
Sequence:CCGGGAGGAGATTGTAACCTTTCTACTCGAGTAGAAAGGTTACAATCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-329s21c1
Sequence:CCGGCATCCAGGCACACCCTAACAACTCGAGTTGTTAGGGTGTGCCTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-299s21c1
Sequence:CCGGCAAAGTGCTCTCAGTTGAAACCTCGAGGTTTCAACTGAGAGCACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-929s21c1
Sequence:CCGGGTGTGAAATGCTCAGCTATACCTCGAGGTATAGCTGAGCATTTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1568s21c1
Sequence:CCGGGGCTTTAGGCTAGCTGTTAAACTCGAGTTTAACAGCTAGCCTAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002435.1-1236s21c1
Sequence:CCGGCCGAAGGACCTGCTGATATTCCTCGAGGAATATCAGCAGGTCCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025837
VALIDATED
MPI MISSION shRNA Bacterial Glycerol Stock
mannose phosphate isomerase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000252480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-212s21c1
Sequence:CCGGAGATCCTTGACAACCGTATTTCTCGAGAAATACGGTTGTCAAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-1264s21c1
Sequence:CCGGCCCAAGGATCTGCTGATATTCCTCGAGGAATATCAGCAGATCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-1421s21c1
Sequence:CCGGAGTAAATTTGGCATTAGTAACCTCGAGGTTACTAATGCCAAATTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025837.2-688s21c1
Sequence:CCGGCGGATCTCCCAGCAAGTATTTCTCGAGAAATACTTGCTGGGAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025837
VALIDATED
MPI MISSION shRNA shRNA Plasmid DNA
mannose phosphate isomerase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000252480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-212s21c1
Sequence:CCGGAGATCCTTGACAACCGTATTTCTCGAGAAATACGGTTGTCAAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-1264s21c1
Sequence:CCGGCCCAAGGATCTGCTGATATTCCTCGAGGAATATCAGCAGATCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-1421s21c1
Sequence:CCGGAGTAAATTTGGCATTAGTAACCTCGAGGTTACTAATGCCAAATTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025837.2-688s21c1
Sequence:CCGGCGGATCTCCCAGCAAGTATTTCTCGAGAAATACTTGCTGGGAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025837
VALIDATED
MPI MISSION shRNA Lentiviral Transduction Particles
mannose phosphate isomerase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000252480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-212s21c1
Sequence:CCGGAGATCCTTGACAACCGTATTTCTCGAGAAATACGGTTGTCAAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-1264s21c1
Sequence:CCGGCCCAAGGATCTGCTGATATTCCTCGAGGAATATCAGCAGATCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025837.2-1421s21c1
Sequence:CCGGAGTAAATTTGGCATTAGTAACCTCGAGGTTACTAATGCCAAATTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025837.2-688s21c1
Sequence:CCGGCGGATCTCCCAGCAAGTATTTCTCGAGAAATACTTGCTGGGAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)