EMAIL THIS PAGE TO A FRIEND

MPLKIP

M-phase specific PLK1 interacting protein

51 Gene Product Result for
Synonyms: ABHS C7orf11 ORF20
UniProtKB ID: Q8TAP9
Gene ID:
Human(136647) Summary: The protein encoded by this gene localizes to the centrosome during mitosis and to the midbody during cytokinesis. The protein is phosphorylated by cyclin-dependent kinase 1 during mitosis and subsequently interacts with polo-like kinase 1. The protein is thought to function in regulating mitosis and cytokinesis. Mutations in this gene result in nonphotosensitive trichothiodystrophy. [provided by RefSeq, Nov 2009]
Mouse(66308) M-phase specific PLK1 intereacting protein
Rat(684996) M-phase specific PLK1 interacting protein
Zebrafish(100003564) M-phase specific PLK1 interacting protein
cow(509064) M-phase specific PLK1 interacting protein
domestic cat(101090502) M-phase specific PLK1 interacting protein
dog(100683984) M-phase specific PLK1 interacting protein
domestic guinea pig(100719228) M-phase specific PLK1 interacting protein
naked mole-rat(101706193) M-phase specific PLK1 interacting protein
sheep(101121255) M-phase specific PLK1 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138701 Rosetta Predictions human pricing
NM_001109452 Rosetta Predictions rat pricing
NM_025479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030219 predicted 543
2 SASI_Hs01_00030220 predicted 639
3 SASI_Hs01_00030221 predicted 679
4 SASI_Hs01_00030222 predicted 258
5 SASI_Hs01_00030223 predicted 541
6 SASI_Hs01_00030224 predicted 714
7 SASI_Hs01_00030226 predicted 513
8 SASI_Hs01_00030227 predicted 443
9 SASI_Hs01_00030228 predicted 553
10 SASI_Hs02_00363800 predicted 567
11 SASI_Hs01_00030225 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109452 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248547 predicted 1176
2 SASI_Rn02_00248548 predicted 1030
3 SASI_Rn02_00248549 predicted 927
4 SASI_Rn02_00248550 predicted 813
5 SASI_Rn02_00248551 predicted 1143
6 SASI_Rn02_00248552 predicted 1169
7 SASI_Rn02_00248553 predicted 1203
8 SASI_Rn02_00248554 predicted 864
9 SASI_Rn02_00248555 predicted 1127
10 SASI_Rn02_00248556 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104782 predicted 1109
2 SASI_Mm01_00104783 predicted 1101
3 SASI_Mm01_00104784 predicted 916
4 SASI_Mm01_00104786 predicted 749
5 SASI_Mm01_00104787 predicted 765
6 SASI_Mm01_00104788 predicted 912
7 SASI_Mm01_00104789 predicted 996
8 SASI_Mm01_00104790 predicted 945
9 SASI_Mm01_00104785 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138701
VALIDATED
MPLKIP MISSION shRNA Bacterial Glycerol Stock
M-phase specific PLK1 interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-412s1c1
Sequence:CCGGCATTTGGATCAGGGCGTGTTACTCGAGTAACACGCCCTGATCCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-712s21c1
Sequence:CCGGCCCAAAGATGATGACTTTGATCTCGAGATCAAAGTCATCATCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138701.2-582s21c1
Sequence:CCGGTACAGCAATACTCAAACATTCCTCGAGGAATGTTTGAGTATTGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-670s1c1
Sequence:CCGGCCCAAAGATGATGACTTTGATCTCGAGATCAAAGTCATCATCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138701.1-475s1c1
Sequence:CCGGCTTCAATGCTTGAAGATCCTTCTCGAGAAGGATCTTCAAGCATTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138701.1-507s1c1
Sequence:CCGGGAACCAGTATCTGTAGTGGATCTCGAGATCCACTACAGATACTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-622s1c1
Sequence:CCGGGTCAGGAACATCTTGGACAAACTCGAGTTTGTCCAAGATGTTCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-484s21c1
Sequence:CCGGGAATGTCTAATGAGTTGGAAACTCGAGTTTCCAACTCATTAGACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-430s21c1
Sequence:CCGGAGGGTTCTCCAAGGACATCTACTCGAGTAGATGTCCTTGGAGAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138701.2-664s21c1
Sequence:CCGGGTCAGGAACATCTTGGACAAACTCGAGTTTGTCCAAGATGTTCCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138701
VALIDATED
MPLKIP MISSION shRNA shRNA Plasmid DNA
M-phase specific PLK1 interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-412s1c1
Sequence:CCGGCATTTGGATCAGGGCGTGTTACTCGAGTAACACGCCCTGATCCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-712s21c1
Sequence:CCGGCCCAAAGATGATGACTTTGATCTCGAGATCAAAGTCATCATCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138701.2-582s21c1
Sequence:CCGGTACAGCAATACTCAAACATTCCTCGAGGAATGTTTGAGTATTGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-670s1c1
Sequence:CCGGCCCAAAGATGATGACTTTGATCTCGAGATCAAAGTCATCATCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138701.1-475s1c1
Sequence:CCGGCTTCAATGCTTGAAGATCCTTCTCGAGAAGGATCTTCAAGCATTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138701.1-507s1c1
Sequence:CCGGGAACCAGTATCTGTAGTGGATCTCGAGATCCACTACAGATACTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-622s1c1
Sequence:CCGGGTCAGGAACATCTTGGACAAACTCGAGTTTGTCCAAGATGTTCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-484s21c1
Sequence:CCGGGAATGTCTAATGAGTTGGAAACTCGAGTTTCCAACTCATTAGACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-430s21c1
Sequence:CCGGAGGGTTCTCCAAGGACATCTACTCGAGTAGATGTCCTTGGAGAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138701.2-664s21c1
Sequence:CCGGGTCAGGAACATCTTGGACAAACTCGAGTTTGTCCAAGATGTTCCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138701
VALIDATED
MPLKIP MISSION shRNA Lentiviral Transduction Particles
M-phase specific PLK1 interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-412s1c1
Sequence:CCGGCATTTGGATCAGGGCGTGTTACTCGAGTAACACGCCCTGATCCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-712s21c1
Sequence:CCGGCCCAAAGATGATGACTTTGATCTCGAGATCAAAGTCATCATCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138701.2-582s21c1
Sequence:CCGGTACAGCAATACTCAAACATTCCTCGAGGAATGTTTGAGTATTGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-670s1c1
Sequence:CCGGCCCAAAGATGATGACTTTGATCTCGAGATCAAAGTCATCATCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138701.1-475s1c1
Sequence:CCGGCTTCAATGCTTGAAGATCCTTCTCGAGAAGGATCTTCAAGCATTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138701.1-507s1c1
Sequence:CCGGGAACCAGTATCTGTAGTGGATCTCGAGATCCACTACAGATACTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138701.1-622s1c1
Sequence:CCGGGTCAGGAACATCTTGGACAAACTCGAGTTTGTCCAAGATGTTCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-484s21c1
Sequence:CCGGGAATGTCTAATGAGTTGGAAACTCGAGTTTCCAACTCATTAGACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138701.2-430s21c1
Sequence:CCGGAGGGTTCTCCAAGGACATCTACTCGAGTAGATGTCCTTGGAGAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138701.2-664s21c1
Sequence:CCGGGTCAGGAACATCTTGGACAAACTCGAGTTTGTCCAAGATGTTCCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025479
VALIDATED
MPLKIP MISSION shRNA Bacterial Glycerol Stock
M-phase specific PLK1 interacting protein
Mouse
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-527s1c1
Sequence:CCGGGAACCAGTGTCTGTAGTGGATCTCGAGATCCACTACAGACACTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025479.5-1097s21c1
Sequence:CCGGATCACTGGAAGTCACTTAATACTCGAGTATTAAGTGACTTCCAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-2251s1c1
Sequence:CCGGCCTAGGTAAGCCATAACTATTCTCGAGAATAGTTATGGCTTACCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.2-763s1c1
Sequence:CCGGGCGGAAATGATAGGACAATTTCTCGAGAAATTGTCCTATCATTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-1730s1c1
Sequence:CCGGGAGACAGTAAGGCCTAATTATCTCGAGATAATTAGGCCTTACTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-564s1c1
Sequence:CCGGGCAATACGCAAACATTCACAGCTCGAGCTGTGAATGTTTGCGTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.2-690s1c1
Sequence:CCGGCCAAGGATGATGACTTTGAATCTCGAGATTCAAAGTCATCATCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-553s1c1
Sequence:CCGGCCAACAGTACAGCAATACGCACTCGAGTGCGTATTGCTGTACTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-530s21c1
Sequence:CCGGCAGTGTCTGTAGTGGATATAACTCGAGTTATATCCACTACAGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025479.5-954s21c1
Sequence:CCGGACTTAGACTTTGAGGGTAAATCTCGAGATTTACCCTCAAAGTCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-466s1c1
Sequence:CCGGGTCTAATGAGTTGGAAAGTTACTCGAGTAACTTTCCAACTCATTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-2411s1c1
Sequence:CCGGGTCTTCATTTAACCCTATATTCTCGAGAATATAGGGTTAAATGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-955s1c1
Sequence:CCGGCTTAGACTTTGAGGGTAAATGCTCGAGCATTTACCCTCAAAGTCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-1323s1c1
Sequence:CCGGGAAGTTCAGCTGGATCTATTACTCGAGTAATAGATCCAGCTGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-466s21c1
Sequence:CCGGTCTAATGAGTTGGAAAGTTATCTCGAGATAACTTTCCAACTCATTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-415s21c1
Sequence:CCGGCCAAGGACATCTACACCATTTCTCGAGAAATGGTGTAGATGTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025479.5-559s21c1
Sequence:CCGGTACAGCAATACGCAAACATTCCTCGAGGAATGTTTGCGTATTGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-541s21c1
Sequence:CCGGGTGGATATAAGCCAACAGTACCTCGAGGTACTGTTGGCTTATATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-487s21c1
Sequence:CCGGTTTAAGCCTTCAATGCTTGAACTCGAGTTCAAGCATTGAAGGCTTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025479
VALIDATED
MPLKIP MISSION shRNA shRNA Plasmid DNA
M-phase specific PLK1 interacting protein
Mouse
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-527s1c1
Sequence:CCGGGAACCAGTGTCTGTAGTGGATCTCGAGATCCACTACAGACACTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025479.5-1097s21c1
Sequence:CCGGATCACTGGAAGTCACTTAATACTCGAGTATTAAGTGACTTCCAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-2251s1c1
Sequence:CCGGCCTAGGTAAGCCATAACTATTCTCGAGAATAGTTATGGCTTACCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.2-763s1c1
Sequence:CCGGGCGGAAATGATAGGACAATTTCTCGAGAAATTGTCCTATCATTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-1730s1c1
Sequence:CCGGGAGACAGTAAGGCCTAATTATCTCGAGATAATTAGGCCTTACTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-564s1c1
Sequence:CCGGGCAATACGCAAACATTCACAGCTCGAGCTGTGAATGTTTGCGTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.2-690s1c1
Sequence:CCGGCCAAGGATGATGACTTTGAATCTCGAGATTCAAAGTCATCATCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-553s1c1
Sequence:CCGGCCAACAGTACAGCAATACGCACTCGAGTGCGTATTGCTGTACTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-530s21c1
Sequence:CCGGCAGTGTCTGTAGTGGATATAACTCGAGTTATATCCACTACAGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025479.5-954s21c1
Sequence:CCGGACTTAGACTTTGAGGGTAAATCTCGAGATTTACCCTCAAAGTCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-466s1c1
Sequence:CCGGGTCTAATGAGTTGGAAAGTTACTCGAGTAACTTTCCAACTCATTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-2411s1c1
Sequence:CCGGGTCTTCATTTAACCCTATATTCTCGAGAATATAGGGTTAAATGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-955s1c1
Sequence:CCGGCTTAGACTTTGAGGGTAAATGCTCGAGCATTTACCCTCAAAGTCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-1323s1c1
Sequence:CCGGGAAGTTCAGCTGGATCTATTACTCGAGTAATAGATCCAGCTGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-466s21c1
Sequence:CCGGTCTAATGAGTTGGAAAGTTATCTCGAGATAACTTTCCAACTCATTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-415s21c1
Sequence:CCGGCCAAGGACATCTACACCATTTCTCGAGAAATGGTGTAGATGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025479.5-559s21c1
Sequence:CCGGTACAGCAATACGCAAACATTCCTCGAGGAATGTTTGCGTATTGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-541s21c1
Sequence:CCGGGTGGATATAAGCCAACAGTACCTCGAGGTACTGTTGGCTTATATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-487s21c1
Sequence:CCGGTTTAAGCCTTCAATGCTTGAACTCGAGTTCAAGCATTGAAGGCTTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025479
VALIDATED
MPLKIP MISSION shRNA Lentiviral Transduction Particles
M-phase specific PLK1 interacting protein
Mouse
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-527s1c1
Sequence:CCGGGAACCAGTGTCTGTAGTGGATCTCGAGATCCACTACAGACACTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025479.5-1097s21c1
Sequence:CCGGATCACTGGAAGTCACTTAATACTCGAGTATTAAGTGACTTCCAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-2251s1c1
Sequence:CCGGCCTAGGTAAGCCATAACTATTCTCGAGAATAGTTATGGCTTACCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.2-763s1c1
Sequence:CCGGGCGGAAATGATAGGACAATTTCTCGAGAAATTGTCCTATCATTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-1730s1c1
Sequence:CCGGGAGACAGTAAGGCCTAATTATCTCGAGATAATTAGGCCTTACTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-564s1c1
Sequence:CCGGGCAATACGCAAACATTCACAGCTCGAGCTGTGAATGTTTGCGTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.2-690s1c1
Sequence:CCGGCCAAGGATGATGACTTTGAATCTCGAGATTCAAAGTCATCATCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-553s1c1
Sequence:CCGGCCAACAGTACAGCAATACGCACTCGAGTGCGTATTGCTGTACTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-530s21c1
Sequence:CCGGCAGTGTCTGTAGTGGATATAACTCGAGTTATATCCACTACAGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025479.5-954s21c1
Sequence:CCGGACTTAGACTTTGAGGGTAAATCTCGAGATTTACCCTCAAAGTCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025479.2-466s1c1
Sequence:CCGGGTCTAATGAGTTGGAAAGTTACTCGAGTAACTTTCCAACTCATTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-2411s1c1
Sequence:CCGGGTCTTCATTTAACCCTATATTCTCGAGAATATAGGGTTAAATGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-955s1c1
Sequence:CCGGCTTAGACTTTGAGGGTAAATGCTCGAGCATTTACCCTCAAAGTCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025479.5-1323s1c1
Sequence:CCGGGAAGTTCAGCTGGATCTATTACTCGAGTAATAGATCCAGCTGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-466s21c1
Sequence:CCGGTCTAATGAGTTGGAAAGTTATCTCGAGATAACTTTCCAACTCATTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-415s21c1
Sequence:CCGGCCAAGGACATCTACACCATTTCTCGAGAAATGGTGTAGATGTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025479.5-559s21c1
Sequence:CCGGTACAGCAATACGCAAACATTCCTCGAGGAATGTTTGCGTATTGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-541s21c1
Sequence:CCGGGTGGATATAAGCCAACAGTACCTCGAGGTACTGTTGGCTTATATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025479.5-487s21c1
Sequence:CCGGTTTAAGCCTTCAATGCTTGAACTCGAGTTCAAGCATTGAAGGCTTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)