EMAIL THIS PAGE TO A FRIEND

MPND

MPN domain containing

50 Gene Product Result for
UniProtKB ID: Q8N594, Q96SJ0, Q9Y2P1, Q9Y2P2
Gene ID:
Mouse(68047) MPN domain containing
Rat(681944) MPN domain containing
sheep(101115123) MPN domain containing
naked mole-rat(101701351) MPN domain containing
domestic guinea pig(100736147) MPN domain containing
Zebrafish(559169) MPN domain containing
cow(512718) MPN domain containing
domestic cat(101080616) MPN domain containing
dog(485040) MPN domain containing
chicken(100858729) MPN domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032868 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032868 Rosetta Predictions human pricing
NM_001085406 Rosetta Predictions rat pricing
NM_026530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162447 predicted 1251
2 SASI_Hs01_00162448 predicted 883
3 SASI_Hs01_00162449 predicted 822
4 SASI_Hs01_00162450 predicted 990
5 SASI_Hs01_00162451 predicted 1223
6 SASI_Hs01_00162452 predicted 1213
7 SASI_Hs01_00162453 predicted 1006
8 SASI_Hs01_00162454 predicted 865
9 SASI_Hs02_00360484 predicted 933
10 SASI_Hs01_00162456 predicted 1285
11 SASI_Hs01_00162455 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209041 predicted 1071
2 SASI_Rn02_00209042 predicted 774
3 SASI_Rn02_00209043 predicted 1281
4 SASI_Rn02_00209044 predicted 779
5 SASI_Rn02_00209045 predicted 1067
6 SASI_Rn02_00209046 predicted 1048
7 SASI_Rn02_00209047 predicted 802
8 SASI_Rn02_00209048 predicted 894
9 SASI_Rn02_00209049 predicted 798
10 SASI_Rn02_00209050 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122102 predicted 1302
2 SASI_Mm01_00122103 predicted 1332
3 SASI_Mm01_00122104 predicted 1104
4 SASI_Mm01_00122105 predicted 1212
5 SASI_Mm02_00330447 predicted 1231
6 SASI_Mm01_00122106 predicted 987
7 SASI_Mm02_00330448 predicted 1402
8 SASI_Mm01_00122108 predicted 829
9 SASI_Mm01_00122109 predicted 1174
10 SASI_Mm01_00122110 predicted 470
11 SASI_Mm01_00122107 predicted 376
12 SASI_Mm01_00122111 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032868
VALIDATED
MPND MISSION shRNA Bacterial Glycerol Stock
MPN domain containing
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1063s21c1
Sequence:CCGGGATCTACCAGAGCCTGTTCCTCTCGAGAGGAACAGGCTCTGGTAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1153s21c1
Sequence:CCGGCATCGACGCACAGATGGACTACTCGAGTAGTCCATCTGTGCGTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1314s21c1
Sequence:CCGGTGGAGTTCTACAAGGGTTCCCCTCGAGGGGAACCCTTGTAGAACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1040s21c1
Sequence:CCGGACTGCAGCTGCCATCGAAGAGCTCGAGCTCTTCGATGGCAGCTGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1262s21c1
Sequence:CCGGGAGTCCAAGATCTCACCTTTCCTCGAGGAAAGGTGAGATCTTGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1375s21c1
Sequence:CCGGCACCTACCTCGACAAGCTTAACTCGAGTTAAGCTTGTCGAGGTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-934s21c1
Sequence:CCGGACGGAGTGAGGTCGTGGGTTACTCGAGTAACCCACGACCTCACTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-387s21c1
Sequence:CCGGAGCCAGACGGAAGGATCATGTCTCGAGACATGATCCTTCCGTCTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032868.2-462s1c1
Sequence:CCGGCTCTGTCAAGTACAAAGGCCACTCGAGTGGCCTTTGTACTTGACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-479s1c1
Sequence:CCGGGCCAGAAACTGGACAAGTACACTCGAGTGTACTTGTCCAGTTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-813s1c1
Sequence:CCGGCATCAACAAGTTCCAGCCGTTCTCGAGAACGGCTGGAACTTGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-787s1c1
Sequence:CCGGCTGGTGGAAGTAACATCCTTTCTCGAGAAAGGATGTTACTTCCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-804s1c1
Sequence:CCGGCTTTGCAGCCATCAACAAGTTCTCGAGAACTTGTTGATGGCTGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-480s1c1
Sequence:CCGGCCAGAAACTGGACAAGTACAACTCGAGTTGTACTTGTCCAGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-466s1c1
Sequence:CCGGGTCAAGTACAAAGGCCAGAAACTCGAGTTTCTGGCCTTTGTACTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032868
VALIDATED
MPND MISSION shRNA shRNA Plasmid DNA
MPN domain containing
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1063s21c1
Sequence:CCGGGATCTACCAGAGCCTGTTCCTCTCGAGAGGAACAGGCTCTGGTAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1153s21c1
Sequence:CCGGCATCGACGCACAGATGGACTACTCGAGTAGTCCATCTGTGCGTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1314s21c1
Sequence:CCGGTGGAGTTCTACAAGGGTTCCCCTCGAGGGGAACCCTTGTAGAACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1040s21c1
Sequence:CCGGACTGCAGCTGCCATCGAAGAGCTCGAGCTCTTCGATGGCAGCTGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1262s21c1
Sequence:CCGGGAGTCCAAGATCTCACCTTTCCTCGAGGAAAGGTGAGATCTTGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1375s21c1
Sequence:CCGGCACCTACCTCGACAAGCTTAACTCGAGTTAAGCTTGTCGAGGTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-934s21c1
Sequence:CCGGACGGAGTGAGGTCGTGGGTTACTCGAGTAACCCACGACCTCACTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-387s21c1
Sequence:CCGGAGCCAGACGGAAGGATCATGTCTCGAGACATGATCCTTCCGTCTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032868.2-462s1c1
Sequence:CCGGCTCTGTCAAGTACAAAGGCCACTCGAGTGGCCTTTGTACTTGACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-479s1c1
Sequence:CCGGGCCAGAAACTGGACAAGTACACTCGAGTGTACTTGTCCAGTTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-813s1c1
Sequence:CCGGCATCAACAAGTTCCAGCCGTTCTCGAGAACGGCTGGAACTTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-787s1c1
Sequence:CCGGCTGGTGGAAGTAACATCCTTTCTCGAGAAAGGATGTTACTTCCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-804s1c1
Sequence:CCGGCTTTGCAGCCATCAACAAGTTCTCGAGAACTTGTTGATGGCTGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-480s1c1
Sequence:CCGGCCAGAAACTGGACAAGTACAACTCGAGTTGTACTTGTCCAGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-466s1c1
Sequence:CCGGGTCAAGTACAAAGGCCAGAAACTCGAGTTTCTGGCCTTTGTACTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032868
VALIDATED
MPND MISSION shRNA Lentiviral Transduction Particles
MPN domain containing
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1063s21c1
Sequence:CCGGGATCTACCAGAGCCTGTTCCTCTCGAGAGGAACAGGCTCTGGTAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1153s21c1
Sequence:CCGGCATCGACGCACAGATGGACTACTCGAGTAGTCCATCTGTGCGTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1314s21c1
Sequence:CCGGTGGAGTTCTACAAGGGTTCCCCTCGAGGGGAACCCTTGTAGAACTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1040s21c1
Sequence:CCGGACTGCAGCTGCCATCGAAGAGCTCGAGCTCTTCGATGGCAGCTGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1262s21c1
Sequence:CCGGGAGTCCAAGATCTCACCTTTCCTCGAGGAAAGGTGAGATCTTGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-1375s21c1
Sequence:CCGGCACCTACCTCGACAAGCTTAACTCGAGTTAAGCTTGTCGAGGTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-934s21c1
Sequence:CCGGACGGAGTGAGGTCGTGGGTTACTCGAGTAACCCACGACCTCACTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032868.4-387s21c1
Sequence:CCGGAGCCAGACGGAAGGATCATGTCTCGAGACATGATCCTTCCGTCTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032868.2-462s1c1
Sequence:CCGGCTCTGTCAAGTACAAAGGCCACTCGAGTGGCCTTTGTACTTGACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-479s1c1
Sequence:CCGGGCCAGAAACTGGACAAGTACACTCGAGTGTACTTGTCCAGTTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-813s1c1
Sequence:CCGGCATCAACAAGTTCCAGCCGTTCTCGAGAACGGCTGGAACTTGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-787s1c1
Sequence:CCGGCTGGTGGAAGTAACATCCTTTCTCGAGAAAGGATGTTACTTCCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_032868.2-804s1c1
Sequence:CCGGCTTTGCAGCCATCAACAAGTTCTCGAGAACTTGTTGATGGCTGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-480s1c1
Sequence:CCGGCCAGAAACTGGACAAGTACAACTCGAGTTGTACTTGTCCAGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032868.2-466s1c1
Sequence:CCGGGTCAAGTACAAAGGCCAGAAACTCGAGTTTCTGGCCTTTGTACTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026530
VALIDATED
MPND MISSION shRNA Bacterial Glycerol Stock
MPN domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026530.5-1077s21c1
Sequence:CCGGTACCCTCCTTGCAGGACATTGCTCGAGCAATGTCCTGCAAGGAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-471s21c1
Sequence:CCGGAGGGCCAGAAGCTGGACAAATCTCGAGATTTGTCCAGCTTCTGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026530.5-903s21c1
Sequence:CCGGGTCGCTGGGACATCAACAATCCTCGAGGATTGTTGATGTCCCAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-819s21c1
Sequence:CCGGACGTGGCCGTTTCCAGTAATGCTCGAGCATTACTGGAAACGGCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-420s21c1
Sequence:CCGGTCGTCAACCCAGCCAAGAAATCTCGAGATTTCTTGGCTGGGTTGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-1236s1c1
Sequence:CCGGCGTATGTCCAAGATAGCTTCTCTCGAGAGAAGCTATCTTGGACATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-717s1c1
Sequence:CCGGCTCTGGTAGAAGTAACATCCTCTCGAGAGGATGTTACTTCTACCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-1351s1c1
Sequence:CCGGGCATACCTACCTGGACAAACTCTCGAGAGTTTGTCCAGGTAGGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026530
VALIDATED
MPND MISSION shRNA shRNA Plasmid DNA
MPN domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026530.5-1077s21c1
Sequence:CCGGTACCCTCCTTGCAGGACATTGCTCGAGCAATGTCCTGCAAGGAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-471s21c1
Sequence:CCGGAGGGCCAGAAGCTGGACAAATCTCGAGATTTGTCCAGCTTCTGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026530.5-903s21c1
Sequence:CCGGGTCGCTGGGACATCAACAATCCTCGAGGATTGTTGATGTCCCAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-819s21c1
Sequence:CCGGACGTGGCCGTTTCCAGTAATGCTCGAGCATTACTGGAAACGGCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-420s21c1
Sequence:CCGGTCGTCAACCCAGCCAAGAAATCTCGAGATTTCTTGGCTGGGTTGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-1236s1c1
Sequence:CCGGCGTATGTCCAAGATAGCTTCTCTCGAGAGAAGCTATCTTGGACATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-717s1c1
Sequence:CCGGCTCTGGTAGAAGTAACATCCTCTCGAGAGGATGTTACTTCTACCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-1351s1c1
Sequence:CCGGGCATACCTACCTGGACAAACTCTCGAGAGTTTGTCCAGGTAGGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026530
VALIDATED
MPND MISSION shRNA Lentiviral Transduction Particles
MPN domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026530.5-1077s21c1
Sequence:CCGGTACCCTCCTTGCAGGACATTGCTCGAGCAATGTCCTGCAAGGAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-471s21c1
Sequence:CCGGAGGGCCAGAAGCTGGACAAATCTCGAGATTTGTCCAGCTTCTGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026530.5-903s21c1
Sequence:CCGGGTCGCTGGGACATCAACAATCCTCGAGGATTGTTGATGTCCCAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-819s21c1
Sequence:CCGGACGTGGCCGTTTCCAGTAATGCTCGAGCATTACTGGAAACGGCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026530.5-420s21c1
Sequence:CCGGTCGTCAACCCAGCCAAGAAATCTCGAGATTTCTTGGCTGGGTTGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-1236s1c1
Sequence:CCGGCGTATGTCCAAGATAGCTTCTCTCGAGAGAAGCTATCTTGGACATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-717s1c1
Sequence:CCGGCTCTGGTAGAAGTAACATCCTCTCGAGAGGATGTTACTTCTACCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026530.2-1351s1c1
Sequence:CCGGGCATACCTACCTGGACAAACTCTCGAGAGTTTGTCCAGGTAGGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)