EMAIL THIS PAGE TO A FRIEND

MPO

myeloperoxidase

79 Gene Product Result for
UniProtKB ID: P05164, A1L4B8, Q14862, Q4PJH5, Q9UCL7
Gene ID:
Human(4353) Summary: Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of netrophils. [provided by RefSeq, Jul 2008]
Mouse(17523) myeloperoxidase
Rat(303413) myeloperoxidase
chicken(417467) myeloperoxidase
dog(609986) myeloperoxidase
cow(511206) myeloperoxidase
Horse(100070920) myeloperoxidase
domestic cat(100142673) myeloperoxidase
naked mole-rat(101707361) myeloperoxidase
Domestic Rabbit(100340692) myeloperoxidase
sheep(101123053) myeloperoxidase
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502167 Anti-MPO antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA021147 Anti-MPO antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA061464 Anti-MPO antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306252 ANTI-MYELOPEROXIDASE (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB5500148 Anti-Myeloperoxidase antibody, Rabbit monoclonal clone SP72, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB1306114 ANTI-MYELOPEROXIDASE(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, western blot pricing
N5787 Anti-Neutrophil Myeloperoxidase antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1409321 Monoclonal Anti-MPO antibody produced in mouse clone 3E11, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB4700446 Monoclonal Anti-MPO-FITC antibody produced in mouse clone CLB-MPO-1/1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB0374 Mouse MPO ELISA Kit for plasma and cell culture supernatant mouse pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0092 AQUA Peptide AVSNEIV[R] African clawed frog, human pricing
AQ0091 AQUA Peptide SPTLGASN[R] dog, human, mouse, rat pricing
AQ0090 AQUA Peptide IANVFTNA[F]R human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000250 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069241 MISSION® esiRNA esiRNA human MPO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000250 Rosetta Predictions human pricing
NM_001107036 Rosetta Predictions rat pricing
NM_010824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196286 predicted 2037
2 SASI_Hs01_00196287 predicted 1419
3 SASI_Hs01_00196288 predicted 2348
4 SASI_Hs02_00302171 predicted 2323
5 SASI_Hs01_00196289 predicted 614
6 SASI_Hs01_00196291 predicted 2467
7 SASI_Hs01_00196292 predicted 1880
8 SASI_Hs01_00196293 predicted 886
9 SASI_Hs01_00196294 predicted 1140
10 SASI_Hs01_00196295 predicted 1080
11 SASI_Hs01_00196290 predicted 1856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224856 predicted 1518
2 SASI_Rn02_00224857 predicted 573
3 SASI_Rn02_00224858 predicted 737
4 SASI_Rn02_00224859 predicted 1630
5 SASI_Rn02_00224860 predicted 827
6 SASI_Rn02_00224861 predicted 1616
7 SASI_Rn02_00224862 predicted 999
8 SASI_Rn02_00224863 predicted 634
9 SASI_Rn02_00224864 predicted 1662
10 SASI_Rn02_00224865 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144826 predicted 2435
2 SASI_Mm01_00144827 predicted 2134
3 SASI_Mm01_00144828 predicted 672
4 SASI_Mm01_00144829 predicted 2411
5 SASI_Mm01_00144830 predicted 2317
6 SASI_Mm01_00144831 predicted 644
7 SASI_Mm01_00144832 predicted 1843
8 SASI_Mm01_00144833 predicted 1716
9 SASI_Mm01_00144834 predicted 1556
10 SASI_Mm01_00144835 predicted 1516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010824
MPO MISSION shRNA Bacterial Glycerol Stock
myeloperoxidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-2308s1c1
Sequence:CCGGCGGAAGCTGATGGCACAATATCTCGAGATATTGTGCCATCAGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-1676s1c1
Sequence:CCGGCCCTCTTTGTTCGAGAGCATACTCGAGTATGCTCTCGAACAAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-933s1c1
Sequence:CCGGGAATGACAAGTATCGCACCATCTCGAGATGGTGCGATACTTGTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-2089s1c1
Sequence:CCGGGCCAAACTGAATCGCCAGAATCTCGAGATTCTGGCGATTCAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-1512s1c1
Sequence:CCGGGCTGGCTGTCAATACACGATTCTCGAGAATCGTGTATTGACAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010824
MPO MISSION shRNA shRNA Plasmid DNA
myeloperoxidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-2308s1c1
Sequence:CCGGCGGAAGCTGATGGCACAATATCTCGAGATATTGTGCCATCAGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-1676s1c1
Sequence:CCGGCCCTCTTTGTTCGAGAGCATACTCGAGTATGCTCTCGAACAAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-933s1c1
Sequence:CCGGGAATGACAAGTATCGCACCATCTCGAGATGGTGCGATACTTGTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-2089s1c1
Sequence:CCGGGCCAAACTGAATCGCCAGAATCTCGAGATTCTGGCGATTCAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-1512s1c1
Sequence:CCGGGCTGGCTGTCAATACACGATTCTCGAGAATCGTGTATTGACAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010824
MPO MISSION shRNA Lentiviral Transduction Particles
myeloperoxidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-2308s1c1
Sequence:CCGGCGGAAGCTGATGGCACAATATCTCGAGATATTGTGCCATCAGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-1676s1c1
Sequence:CCGGCCCTCTTTGTTCGAGAGCATACTCGAGTATGCTCTCGAACAAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-933s1c1
Sequence:CCGGGAATGACAAGTATCGCACCATCTCGAGATGGTGCGATACTTGTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-2089s1c1
Sequence:CCGGGCCAAACTGAATCGCCAGAATCTCGAGATTCTGGCGATTCAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010824.1-1512s1c1
Sequence:CCGGGCTGGCTGTCAATACACGATTCTCGAGAATCGTGTATTGACAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000250
MPO MISSION shRNA Bacterial Glycerol Stock
myeloperoxidase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-2310s1c1
Sequence:CCGGCGTGTCTAAGAACAACATCTTCTCGAGAAGATGTTGTTCTTAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-919s1c1
Sequence:CCGGCGCTCACTCATGTTCATGCAACTCGAGTTGCATGAACATGAGTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-2043s1c1
Sequence:CCGGGAACCTGAAATTGGCGAGGAACTCGAGTTCCTCGCCAATTTCAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-684s1c1
Sequence:CCGGGCAGGACAAATACCGCACCATCTCGAGATGGTGCGGTATTTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-1887s1c1
Sequence:CCGGGCGATTGTTTGAGCAGGTCATCTCGAGATGACCTGCTCAAACAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000250.1-1607s21c1
Sequence:CCGGCCACGTACCGTTCCTACAATGCTCGAGCATTGTAGGAACGGTACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000250.1-1847s21c1
Sequence:CCGGTGAATCGTCAGAACCAAATTGCTCGAGCAATTTGGTTCTGACGATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000250.1-2530s21c1
Sequence:CCGGTGAGTGACTAGACGTTCATTTCTCGAGAAATGAACGTCTAGTCACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000250.1-2556s21c1
Sequence:CCGGCTCATGTATGTGCGAAGTATACTCGAGTATACTTCGCACATACATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000250
MPO MISSION shRNA shRNA Plasmid DNA
myeloperoxidase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-2310s1c1
Sequence:CCGGCGTGTCTAAGAACAACATCTTCTCGAGAAGATGTTGTTCTTAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-919s1c1
Sequence:CCGGCGCTCACTCATGTTCATGCAACTCGAGTTGCATGAACATGAGTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-2043s1c1
Sequence:CCGGGAACCTGAAATTGGCGAGGAACTCGAGTTCCTCGCCAATTTCAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-684s1c1
Sequence:CCGGGCAGGACAAATACCGCACCATCTCGAGATGGTGCGGTATTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-1887s1c1
Sequence:CCGGGCGATTGTTTGAGCAGGTCATCTCGAGATGACCTGCTCAAACAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000250.1-1607s21c1
Sequence:CCGGCCACGTACCGTTCCTACAATGCTCGAGCATTGTAGGAACGGTACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000250.1-1847s21c1
Sequence:CCGGTGAATCGTCAGAACCAAATTGCTCGAGCAATTTGGTTCTGACGATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000250.1-2530s21c1
Sequence:CCGGTGAGTGACTAGACGTTCATTTCTCGAGAAATGAACGTCTAGTCACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000250.1-2556s21c1
Sequence:CCGGCTCATGTATGTGCGAAGTATACTCGAGTATACTTCGCACATACATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000250
MPO MISSION shRNA Lentiviral Transduction Particles
myeloperoxidase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-2310s1c1
Sequence:CCGGCGTGTCTAAGAACAACATCTTCTCGAGAAGATGTTGTTCTTAGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-919s1c1
Sequence:CCGGCGCTCACTCATGTTCATGCAACTCGAGTTGCATGAACATGAGTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-2043s1c1
Sequence:CCGGGAACCTGAAATTGGCGAGGAACTCGAGTTCCTCGCCAATTTCAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-684s1c1
Sequence:CCGGGCAGGACAAATACCGCACCATCTCGAGATGGTGCGGTATTTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000250.1-1887s1c1
Sequence:CCGGGCGATTGTTTGAGCAGGTCATCTCGAGATGACCTGCTCAAACAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000250.1-1607s21c1
Sequence:CCGGCCACGTACCGTTCCTACAATGCTCGAGCATTGTAGGAACGGTACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000250.1-1847s21c1
Sequence:CCGGTGAATCGTCAGAACCAAATTGCTCGAGCAATTTGGTTCTGACGATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000250.1-2530s21c1
Sequence:CCGGTGAGTGACTAGACGTTCATTTCTCGAGAAATGAACGTCTAGTCACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000250.1-2556s21c1
Sequence:CCGGCTCATGTATGTGCGAAGTATACTCGAGTATACTTCGCACATACATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)