EMAIL THIS PAGE TO A FRIEND

MPP1

membrane protein, palmitoylated 1, 55kDa

51 Gene Product Result for
Synonyms: AAG12 DXS552E EMP55 MRG1 PEMP
UniProtKB ID: Q00013, B4DZV5, G3XAI1, Q2TSB6, Q5J7V5
Gene ID:
Human(4354) Summary: This gene encodes the prototype of the membrane-associated guanylate kinase (MAGUK) family proteins. MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. The encoded protein is an extensively palmitoylated membrane phosphoprotein containing a PDZ domain, a Src homology 3 (SH3) motif, and a guanylate kinase domain. This gene product interacts with various cytoskeletal proteins and cell junctional proteins in different tissue and cell types, and may be involved in the regulation of cell shape, hair cell development, neural patterning of the retina, and apico-basal polarity and tumor suppression pathways in non-erythroid cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(17524) membrane protein, palmitoylated
sheep(101103539) membrane protein, palmitoylated 1, 55kDa
Domestic Rabbit(100328768) membrane protein, palmitoylated 1, 55kDa
naked mole-rat(101722348) membrane protein, palmitoylated 1, 55kDa
domestic guinea pig(100721105) membrane protein, palmitoylated 1, 55kDa
Zebrafish(325542) membrane protein, palmitoylated 1
chicken(422197) membrane protein, palmitoylated 1, 55kDa
domestic cat(101092503) membrane protein, palmitoylated 1, 55kDa
Horse(100063094) membrane protein, palmitoylated 1, 55kDa
cow(510998) membrane protein, palmitoylated 1, 55kDa
dog(612626) membrane protein, palmitoylated 1, 55kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002436 Rosetta Predictions human pricing
NM_008621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182730 predicted 1503
2 SASI_Hs01_00182731 predicted 528
3 SASI_Hs01_00182732 predicted 357
4 SASI_Hs01_00182733 predicted 677
5 SASI_Hs01_00182734 predicted 212
6 SASI_Hs01_00182735 predicted 1413
7 SASI_Hs01_00182736 predicted 342
8 SASI_Hs01_00182738 predicted 1438
9 SASI_Hs01_00182739 predicted 453
10 SASI_Hs02_00333836 predicted 609
11 SASI_Hs01_00182737 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160508 predicted 1188
2 SASI_Mm01_00160509 predicted 534
3 SASI_Mm01_00160510 predicted 1422
4 SASI_Mm01_00160511 predicted 1452
5 SASI_Mm01_00160512 predicted 1384
6 SASI_Mm01_00160513 predicted 682
7 SASI_Mm01_00160514 predicted 492
8 SASI_Mm02_00314302 predicted 462
9 SASI_Mm01_00160515 predicted 217
10 SASI_Mm01_00160516 predicted 218
11 SASI_Mm01_00160517 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002436
VALIDATED
MPP1 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 1, 55kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1627s21c1
Sequence:GTACCGGGCTCTCTGCAGCTATCCTAATCTCGAGATTAGGATAGCTGCAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1677s21c1
Sequence:CCGGAGGCTCCTGAAGGGTTGATTCCTCGAGGAATCAACCCTTCAGGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002436.2-1386s21c1
Sequence:CCGGGCCAGTACGCTCACTACTTTGCTCGAGCAAAGTAGTGAGCGTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-312s21c1
Sequence:CCGGTGCGGAAAGTGCGACTCATACCTCGAGGTATGAGTCGCACTTTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002436.2-1216s21c1
Sequence:CCGGCCAGATCCATAAGCAGAACAACTCGAGTTGTTCTGCTTATGGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1286s21c1
Sequence:CCGGGCAGAACTTTCGCCTTTCATTCTCGAGAATGAAAGGCGAAAGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1216s1c1
Sequence:CCGGCCAGATCCATAAGCAGAACAACTCGAGTTGTTCTGCTTATGGATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002436.2-214s1c1
Sequence:CCGGAGAGGCTGTATCGCATCCATTCTCGAGAATGGATGCGATACAGCCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1714s1c1
Sequence:CCGGCCCACTGATCTGGATTTGAAACTCGAGTTTCAAATCCAGATCAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1286s1c1
Sequence:CCGGGCAGAACTTTCGCCTTTCATTCTCGAGAATGAAAGGCGAAAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-610s1c1
Sequence:CCGGGCAGTTTGACTATGATCCCAACTCGAGTTGGGATCATAGTCAAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002436
VALIDATED
MPP1 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 1, 55kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1627s21c1
Sequence:GTACCGGGCTCTCTGCAGCTATCCTAATCTCGAGATTAGGATAGCTGCAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1677s21c1
Sequence:CCGGAGGCTCCTGAAGGGTTGATTCCTCGAGGAATCAACCCTTCAGGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002436.2-1386s21c1
Sequence:CCGGGCCAGTACGCTCACTACTTTGCTCGAGCAAAGTAGTGAGCGTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-312s21c1
Sequence:CCGGTGCGGAAAGTGCGACTCATACCTCGAGGTATGAGTCGCACTTTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002436.2-1216s21c1
Sequence:CCGGCCAGATCCATAAGCAGAACAACTCGAGTTGTTCTGCTTATGGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1286s21c1
Sequence:CCGGGCAGAACTTTCGCCTTTCATTCTCGAGAATGAAAGGCGAAAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1216s1c1
Sequence:CCGGCCAGATCCATAAGCAGAACAACTCGAGTTGTTCTGCTTATGGATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002436.2-214s1c1
Sequence:CCGGAGAGGCTGTATCGCATCCATTCTCGAGAATGGATGCGATACAGCCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1714s1c1
Sequence:CCGGCCCACTGATCTGGATTTGAAACTCGAGTTTCAAATCCAGATCAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1286s1c1
Sequence:CCGGGCAGAACTTTCGCCTTTCATTCTCGAGAATGAAAGGCGAAAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-610s1c1
Sequence:CCGGGCAGTTTGACTATGATCCCAACTCGAGTTGGGATCATAGTCAAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002436
VALIDATED
MPP1 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 1, 55kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1627s21c1
Sequence:GTACCGGGCTCTCTGCAGCTATCCTAATCTCGAGATTAGGATAGCTGCAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1677s21c1
Sequence:CCGGAGGCTCCTGAAGGGTTGATTCCTCGAGGAATCAACCCTTCAGGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002436.2-1386s21c1
Sequence:CCGGGCCAGTACGCTCACTACTTTGCTCGAGCAAAGTAGTGAGCGTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-312s21c1
Sequence:CCGGTGCGGAAAGTGCGACTCATACCTCGAGGTATGAGTCGCACTTTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002436.2-1216s21c1
Sequence:CCGGCCAGATCCATAAGCAGAACAACTCGAGTTGTTCTGCTTATGGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002436.2-1286s21c1
Sequence:CCGGGCAGAACTTTCGCCTTTCATTCTCGAGAATGAAAGGCGAAAGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1216s1c1
Sequence:CCGGCCAGATCCATAAGCAGAACAACTCGAGTTGTTCTGCTTATGGATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002436.2-214s1c1
Sequence:CCGGAGAGGCTGTATCGCATCCATTCTCGAGAATGGATGCGATACAGCCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1714s1c1
Sequence:CCGGCCCACTGATCTGGATTTGAAACTCGAGTTTCAAATCCAGATCAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-1286s1c1
Sequence:CCGGGCAGAACTTTCGCCTTTCATTCTCGAGAATGAAAGGCGAAAGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002436.2-610s1c1
Sequence:CCGGGCAGTTTGACTATGATCCCAACTCGAGTTGGGATCATAGTCAAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008621
VALIDATED
MPP1 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 1, 55kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1156s21c1
Sequence:CCGGGCCAATGAGTTCTTGGAGTTTCTCGAGAAACTCCAAGAACTCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1224s21c1
Sequence:CCGGCCAGATTCATAAGCAGGACAACTCGAGTTGTCCTGCTTATGAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-675s21c1
Sequence:CCGGGAAGTTTGTTACTGGAGACATCTCGAGATGTCTCCAGTAACAAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1294s21c1
Sequence:CCGGGCTGAGCTTTCACCTTTCATTCTCGAGAATGAAAGGTGAAAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1156s1c1
Sequence:CCGGGCCAATGAGTTCTTGGAGTTTCTCGAGAAACTCCAAGAACTCATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1224s1c1
Sequence:CCGGCCAGATTCATAAGCAGGACAACTCGAGTTGTCCTGCTTATGAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1294s1c1
Sequence:CCGGGCTGAGCTTTCACCTTTCATTCTCGAGAATGAAAGGTGAAAGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-195s1c1
Sequence:CCGGGCACTTACTACAGAAGCGTAACTCGAGTTACGCTTCTGTAGTAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-675s1c1
Sequence:CCGGGAAGTTTGTTACTGGAGACATCTCGAGATGTCTCCAGTAACAAACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008621
VALIDATED
MPP1 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 1, 55kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1156s21c1
Sequence:CCGGGCCAATGAGTTCTTGGAGTTTCTCGAGAAACTCCAAGAACTCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1224s21c1
Sequence:CCGGCCAGATTCATAAGCAGGACAACTCGAGTTGTCCTGCTTATGAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-675s21c1
Sequence:CCGGGAAGTTTGTTACTGGAGACATCTCGAGATGTCTCCAGTAACAAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1294s21c1
Sequence:CCGGGCTGAGCTTTCACCTTTCATTCTCGAGAATGAAAGGTGAAAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1156s1c1
Sequence:CCGGGCCAATGAGTTCTTGGAGTTTCTCGAGAAACTCCAAGAACTCATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1224s1c1
Sequence:CCGGCCAGATTCATAAGCAGGACAACTCGAGTTGTCCTGCTTATGAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1294s1c1
Sequence:CCGGGCTGAGCTTTCACCTTTCATTCTCGAGAATGAAAGGTGAAAGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-195s1c1
Sequence:CCGGGCACTTACTACAGAAGCGTAACTCGAGTTACGCTTCTGTAGTAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-675s1c1
Sequence:CCGGGAAGTTTGTTACTGGAGACATCTCGAGATGTCTCCAGTAACAAACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008621
VALIDATED
MPP1 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 1, 55kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1156s21c1
Sequence:CCGGGCCAATGAGTTCTTGGAGTTTCTCGAGAAACTCCAAGAACTCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1224s21c1
Sequence:CCGGCCAGATTCATAAGCAGGACAACTCGAGTTGTCCTGCTTATGAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-675s21c1
Sequence:CCGGGAAGTTTGTTACTGGAGACATCTCGAGATGTCTCCAGTAACAAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008621.2-1294s21c1
Sequence:CCGGGCTGAGCTTTCACCTTTCATTCTCGAGAATGAAAGGTGAAAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1156s1c1
Sequence:CCGGGCCAATGAGTTCTTGGAGTTTCTCGAGAAACTCCAAGAACTCATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1224s1c1
Sequence:CCGGCCAGATTCATAAGCAGGACAACTCGAGTTGTCCTGCTTATGAATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-1294s1c1
Sequence:CCGGGCTGAGCTTTCACCTTTCATTCTCGAGAATGAAAGGTGAAAGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-195s1c1
Sequence:CCGGGCACTTACTACAGAAGCGTAACTCGAGTTACGCTTCTGTAGTAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008621.2-675s1c1
Sequence:CCGGGAAGTTTGTTACTGGAGACATCTCGAGATGTCTCCAGTAACAAACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)