EMAIL THIS PAGE TO A FRIEND

MPP2

membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)

318 Gene Product Result for
Synonyms: DLG2
UniProtKB ID: Q14168, Q53ES9, Q5CZB9, Q9BQJ2
Gene ID:
Human(4355) Summary: Palmitoylated membrane protein 2 is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. Palmitoylated membrane protein 2 contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. [provided by RefSeq, Jul 2008]
Mouse(50997) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Rat(85275) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
chicken(420006) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
dog(490945) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
cow(509346) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Horse(100050929) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Horse(100051607) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
domestic cat(101096021) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
domestic guinea pig(100724082) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
naked mole-rat(101696809) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Domestic Rabbit(100345988) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
sheep(101111724) membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005374 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005374 Rosetta Predictions human pricing
XM_001081487 Rosetta Predictions rat pricing
XM_340912 Rosetta Predictions rat pricing
NM_016695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194633 predicted 396
2 SASI_Hs01_00194634 predicted 408
3 SASI_Hs01_00194636 predicted 400
4 SASI_Hs01_00194637 predicted 1261
5 SASI_Hs01_00194638 predicted 1575
6 SASI_Hs02_00339478 predicted 318
7 SASI_Hs01_00194639 predicted 1282
8 SASI_Hs01_00194640 predicted 409
9 SASI_Hs01_00194641 predicted 1990
10 SASI_Hs02_00339479 predicted 989
11 SASI_Hs01_00194635 predicted 1568
12 SASI_Hs01_00194642 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372137 predicted 254
2 SASI_Rn02_00372138 predicted 1814
3 SASI_Rn02_00372139 predicted 913
4 SASI_Rn02_00372140 predicted 269
5 SASI_Rn02_00372141 predicted 1117
6 SASI_Rn02_00372142 predicted 1408
7 SASI_Rn02_00372143 predicted 1858
8 SASI_Rn02_00372144 predicted 928
9 SASI_Rn02_00372145 predicted 1532
10 SASI_Rn02_00372146 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392110 predicted 529
2 SASI_Rn02_00392111 predicted 579
3 SASI_Rn02_00392112 predicted 915
4 SASI_Rn02_00392113 predicted 274
5 SASI_Rn02_00392114 predicted 930
6 SASI_Rn02_00392115 predicted 610
7 SASI_Rn02_00392116 predicted 285
8 SASI_Rn02_00392117 predicted 564
9 SASI_Rn02_00392118 predicted 773
10 SASI_Rn02_00392119 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123202 predicted 1353
2 SASI_Mm01_00123203 predicted 209
3 SASI_Mm01_00123204 predicted 218
4 SASI_Mm01_00123205 predicted 1067
5 SASI_Mm01_00123206 predicted 1982
6 SASI_Mm01_00123207 predicted 1511
7 SASI_Mm01_00123208 predicted 1498
8 SASI_Mm01_00123209 predicted 1512
9 SASI_Mm01_00123210 predicted 972
10 SASI_Mm01_00123211 predicted 2036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016695
VALIDATED
MPP2 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-789s1c1
Sequence:CCGGCCCGACAGGTATTTGTTAAATCTCGAGATTTAACAAATACCTGTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-1511s1c1
Sequence:CCGGGTGTTCATAGAGGCTCCTGATCTCGAGATCAGGAGCCTCTATGAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-1112s1c1
Sequence:CCGGCGCCATGAGCTGCTCATTTATCTCGAGATAAATGAGCAGCTCATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016695.1-890s1c1
Sequence:CCGGCTCCAGATTGTAAACCAAGATCTCGAGATCTTGGTTTACAATCTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016695.3-2261s21c1
Sequence:CCGGCTAGGCAGACCCAGGTAATAGCTCGAGCTATTACCTGGGTCTGCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-573s21c1
Sequence:CCGGGAACACCTGGGTGTGACATTCCTCGAGGAATGTCACACCCAGGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-1375s21c1
Sequence:CCGGACCTAGAACATGGCGAGTATGCTCGAGCATACTCGCCATGTTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-903s21c1
Sequence:CCGGCTCCAGATTGTAAACCAAGATCTCGAGATCTTGGTTTACAATCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-227s21c1
Sequence:CCGGGATCTTTCTTCGAGGCATAATCTCGAGATTATGCCTCGAAGAAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016695
VALIDATED
MPP2 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-789s1c1
Sequence:CCGGCCCGACAGGTATTTGTTAAATCTCGAGATTTAACAAATACCTGTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-1511s1c1
Sequence:CCGGGTGTTCATAGAGGCTCCTGATCTCGAGATCAGGAGCCTCTATGAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-1112s1c1
Sequence:CCGGCGCCATGAGCTGCTCATTTATCTCGAGATAAATGAGCAGCTCATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016695.1-890s1c1
Sequence:CCGGCTCCAGATTGTAAACCAAGATCTCGAGATCTTGGTTTACAATCTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016695.3-2261s21c1
Sequence:CCGGCTAGGCAGACCCAGGTAATAGCTCGAGCTATTACCTGGGTCTGCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-573s21c1
Sequence:CCGGGAACACCTGGGTGTGACATTCCTCGAGGAATGTCACACCCAGGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-1375s21c1
Sequence:CCGGACCTAGAACATGGCGAGTATGCTCGAGCATACTCGCCATGTTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-903s21c1
Sequence:CCGGCTCCAGATTGTAAACCAAGATCTCGAGATCTTGGTTTACAATCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-227s21c1
Sequence:CCGGGATCTTTCTTCGAGGCATAATCTCGAGATTATGCCTCGAAGAAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016695
VALIDATED
MPP2 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-789s1c1
Sequence:CCGGCCCGACAGGTATTTGTTAAATCTCGAGATTTAACAAATACCTGTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-1511s1c1
Sequence:CCGGGTGTTCATAGAGGCTCCTGATCTCGAGATCAGGAGCCTCTATGAACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016695.1-1112s1c1
Sequence:CCGGCGCCATGAGCTGCTCATTTATCTCGAGATAAATGAGCAGCTCATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016695.1-890s1c1
Sequence:CCGGCTCCAGATTGTAAACCAAGATCTCGAGATCTTGGTTTACAATCTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016695.3-2261s21c1
Sequence:CCGGCTAGGCAGACCCAGGTAATAGCTCGAGCTATTACCTGGGTCTGCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-573s21c1
Sequence:CCGGGAACACCTGGGTGTGACATTCCTCGAGGAATGTCACACCCAGGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-1375s21c1
Sequence:CCGGACCTAGAACATGGCGAGTATGCTCGAGCATACTCGCCATGTTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-903s21c1
Sequence:CCGGCTCCAGATTGTAAACCAAGATCTCGAGATCTTGGTTTACAATCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016695.3-227s21c1
Sequence:CCGGGATCTTTCTTCGAGGCATAATCTCGAGATTATGCCTCGAAGAAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005374
VALIDATED
MPP2 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1301s21c1
Sequence:CCGGCCGTCATGAGCTGCTCATTTACTCGAGTAAATGAGCAGCTCATGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-3973s1c1
Sequence:CCGGCCACAGCTCTATGACTCTGTTCTCGAGAACAGAGTCATAGAGCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005374.2-859s1c1
Sequence:CCGGCAGATCGTAAACCAGGATGATCTCGAGATCATCCTGGTTTACGATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-178s1c1
Sequence:CCGGCTGATCTTCCTTCGAGGCATTCTCGAGAATGCCTCGAAGGAAGATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-1353s1c1
Sequence:CCGGCAACCTGTATGGCACACGTATCTCGAGATACGTGTGCCATACAGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005374.2-755s1c1
Sequence:CCGGCCCGCCAGGTATTTGTGAAATCTCGAGATTTCACAAATACCTGGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1550s21c1
Sequence:CCGGCTACCTGGAGCATGGCGAATACTCGAGTATTCGCCATGCTCCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-404s21c1
Sequence:CCGGGATCTTCCTTCGAGGCATTATCTCGAGATAATGCCTCGAAGGAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005374.3-3700s21c1
Sequence:CCGGGTTGGTGTGGCTCTGCGTATACTCGAGTATACGCAGAGCCACACCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1073s21c1
Sequence:CCGGGGACTTGCTCCAGATCGTAAACTCGAGTTTACGATCTGGAGCAAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005374
VALIDATED
MPP2 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1301s21c1
Sequence:CCGGCCGTCATGAGCTGCTCATTTACTCGAGTAAATGAGCAGCTCATGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-3973s1c1
Sequence:CCGGCCACAGCTCTATGACTCTGTTCTCGAGAACAGAGTCATAGAGCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005374.2-859s1c1
Sequence:CCGGCAGATCGTAAACCAGGATGATCTCGAGATCATCCTGGTTTACGATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-178s1c1
Sequence:CCGGCTGATCTTCCTTCGAGGCATTCTCGAGAATGCCTCGAAGGAAGATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-1353s1c1
Sequence:CCGGCAACCTGTATGGCACACGTATCTCGAGATACGTGTGCCATACAGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005374.2-755s1c1
Sequence:CCGGCCCGCCAGGTATTTGTGAAATCTCGAGATTTCACAAATACCTGGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1550s21c1
Sequence:CCGGCTACCTGGAGCATGGCGAATACTCGAGTATTCGCCATGCTCCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-404s21c1
Sequence:CCGGGATCTTCCTTCGAGGCATTATCTCGAGATAATGCCTCGAAGGAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005374.3-3700s21c1
Sequence:CCGGGTTGGTGTGGCTCTGCGTATACTCGAGTATACGCAGAGCCACACCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1073s21c1
Sequence:CCGGGGACTTGCTCCAGATCGTAAACTCGAGTTTACGATCTGGAGCAAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005374
VALIDATED
MPP2 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1301s21c1
Sequence:CCGGCCGTCATGAGCTGCTCATTTACTCGAGTAAATGAGCAGCTCATGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-3973s1c1
Sequence:CCGGCCACAGCTCTATGACTCTGTTCTCGAGAACAGAGTCATAGAGCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005374.2-859s1c1
Sequence:CCGGCAGATCGTAAACCAGGATGATCTCGAGATCATCCTGGTTTACGATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-178s1c1
Sequence:CCGGCTGATCTTCCTTCGAGGCATTCTCGAGAATGCCTCGAAGGAAGATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005374.2-1353s1c1
Sequence:CCGGCAACCTGTATGGCACACGTATCTCGAGATACGTGTGCCATACAGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005374.2-755s1c1
Sequence:CCGGCCCGCCAGGTATTTGTGAAATCTCGAGATTTCACAAATACCTGGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1550s21c1
Sequence:CCGGCTACCTGGAGCATGGCGAATACTCGAGTATTCGCCATGCTCCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-404s21c1
Sequence:CCGGGATCTTCCTTCGAGGCATTATCTCGAGATAATGCCTCGAAGGAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005374.3-3700s21c1
Sequence:CCGGGTTGGTGTGGCTCTGCGTATACTCGAGTATACGCAGAGCCACACCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005374.3-1073s21c1
Sequence:CCGGGGACTTGCTCCAGATCGTAAACTCGAGTTTACGATCTGGAGCAAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)