EMAIL THIS PAGE TO A FRIEND

MPP3

membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)

245 Gene Product Result for
Synonyms: DLG3
UniProtKB ID: Q13368, B2R7N0, D3DX47, Q4GX05, Q6PGR3, Q86SV1
Gene ID:
Human(4356) Summary: This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]
Mouse(13384) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Rat(114202) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
chicken(419985) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
dog(490947) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
domestic cat(101095530) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Horse(100051680) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
cow(508710) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
sheep(101111034) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Domestic Rabbit(100349185) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
naked mole-rat(101701067) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
domestic guinea pig(100724359) membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001932 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001932 Rosetta Predictions human pricing
NR_003562 Rosetta Predictions human pricing
XM_001061133 Rosetta Predictions rat pricing
XM_001081481 Rosetta Predictions rat pricing
XM_001081482 Rosetta Predictions rat pricing
XM_340911 Rosetta Predictions rat pricing
NM_007863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012654 predicted 487
2 SASI_Hs02_00332832 predicted 1156
3 SASI_Hs01_00012655 predicted 690
4 SASI_Hs01_00012657 predicted 563
5 SASI_Hs01_00012658 predicted 1494
6 SASI_Hs02_00332833 predicted 313
7 SASI_Hs01_00012659 predicted 321
8 SASI_Hs01_00012661 predicted 1485
9 SASI_Hs01_00012662 predicted 1456
10 SASI_Hs01_00012663 predicted 1158
11 SASI_Hs01_00012656 predicted 358
12 SASI_Hs01_00012660 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379543 predicted 482
2 SASI_Hs02_00379544 predicted 1135
3 SASI_Hs02_00379545 predicted 691
4 SASI_Hs02_00379546 predicted 561
5 SASI_Hs02_00379547 predicted 1470
6 SASI_Hs02_00379548 predicted 315
7 SASI_Hs02_00379549 predicted 316
8 SASI_Hs02_00379550 predicted 1465
9 SASI_Hs02_00379551 predicted 1432
10 SASI_Hs02_00379552 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298878 predicted 1177
2 SASI_Rn02_00298879 predicted 2276
3 SASI_Rn02_00298880 predicted 1985
4 SASI_Rn02_00298881 predicted 1738
5 SASI_Rn02_00298882 predicted 719
6 SASI_Rn02_00298883 predicted 442
7 SASI_Rn02_00298884 predicted 1323
8 SASI_Rn02_00298885 predicted 1754
9 SASI_Rn02_00298886 predicted 1685
10 SASI_Rn02_00298887 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372083 predicted 1171
2 SASI_Rn02_00372084 predicted 2274
3 SASI_Rn02_00372085 predicted 1982
4 SASI_Rn02_00372086 predicted 1742
5 SASI_Rn02_00372087 predicted 719
6 SASI_Rn02_00372088 predicted 434
7 SASI_Rn02_00372089 predicted 1320
8 SASI_Rn02_00372090 predicted 1749
9 SASI_Rn02_00372091 predicted 1689
10 SASI_Rn02_00372092 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372093 predicted 1179
2 SASI_Rn02_00372094 predicted 2050
3 SASI_Rn02_00372095 predicted 1801
4 SASI_Rn02_00372096 predicted 724
5 SASI_Rn02_00372097 predicted 438
6 SASI_Rn02_00372098 predicted 1391
7 SASI_Rn02_00372099 predicted 1814
8 SASI_Rn02_00372100 predicted 1751
9 SASI_Rn02_00372101 predicted 457
10 SASI_Rn02_00372102 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392100 predicted 1180
2 SASI_Rn02_00392101 predicted 2041
3 SASI_Rn02_00392102 predicted 1802
4 SASI_Rn02_00392103 predicted 724
5 SASI_Rn02_00392104 predicted 441
6 SASI_Rn02_00392105 predicted 1389
7 SASI_Rn02_00392106 predicted 1816
8 SASI_Rn02_00392107 predicted 1748
9 SASI_Rn02_00392108 predicted 454
10 SASI_Rn02_00392109 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079609 predicted 1509
2 SASI_Mm02_00312641 predicted 1183
3 SASI_Mm02_00312642 predicted 1613
4 SASI_Mm01_00079610 predicted 1809
5 SASI_Mm01_00079612 predicted 1902
6 SASI_Mm01_00079617 predicted 1615
7 SASI_Mm01_00079618 predicted 1674
8 SASI_Mm02_00312643 predicted 297
9 SASI_Mm02_00312644 predicted 1744
10 SASI_Mm02_00312645 predicted 1419
11 SASI_Mm01_00079611 predicted 1460
12 SASI_Mm01_00079613 predicted 1123
13 SASI_Mm01_00079614 predicted 765
14 SASI_Mm01_00079615 predicted 1707
15 SASI_Mm01_00079616 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007863
MPP3 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007863.2-2276s21c1
Sequence:CCGGTACCATGATGTTTCAGCTTTACTCGAGTAAAGCTGAAACATCATGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1542s21c1
Sequence:CCGGCCTGGAGCATGGAGAATATAACTCGAGTTATATTCTCCATGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-775s21c1
Sequence:CCGGCCAGACGAGATCAGCCAAATTCTCGAGAATTTGGCTGATCTCGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007863.2-2163s21c1
Sequence:CCGGGAATAGCGTGTTGTTCATTAACTCGAGTTAATGAACAACACGCTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1674s21c1
Sequence:CCGGGTTTAAGCCCTATGTTATATTCTCGAGAATATAACATAGGGCTTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-337s21c1
Sequence:CCGGCATGAGAAACTCCGCTATTATCTCGAGATAATAGCGGAGTTTCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-306s21c1
Sequence:CCGGTGAGAAGAGCCTCAGTTATTTCTCGAGAAATAACTGAGGCTCTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-800s21c1
Sequence:CCGGCCCAATCCCAGGGATCCATTACTCGAGTAATGGATCCCTGGGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1174s21c1
Sequence:CCGGGGGTACTTTAAAGGACATTATCTCGAGATAATGTCCTTTAAAGTACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-507s1c1
Sequence:CCGGCCCGATAACATCGATGAGGATCTCGAGATCCTCATCGATGTTATCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-1755s1c1
Sequence:CCGGGCCTTCATAGATCAGCACTATCTCGAGATAGTGCTGATCTATGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-726s1c1
Sequence:CCGGCCAGACGAGATCAGCCAAATTCTCGAGAATTTGGCTGATCTCGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-1631s1c1
Sequence:CCGGGCCCTATGTTATATTTGTGAACTCGAGTTCACAAATATAACATAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-288s1c1
Sequence:CCGGCACGAGAAACTCCGCTATTATCTCGAGATAATAGCGGAGTTTCTCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007863
MPP3 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007863.2-2276s21c1
Sequence:CCGGTACCATGATGTTTCAGCTTTACTCGAGTAAAGCTGAAACATCATGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1542s21c1
Sequence:CCGGCCTGGAGCATGGAGAATATAACTCGAGTTATATTCTCCATGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-775s21c1
Sequence:CCGGCCAGACGAGATCAGCCAAATTCTCGAGAATTTGGCTGATCTCGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007863.2-2163s21c1
Sequence:CCGGGAATAGCGTGTTGTTCATTAACTCGAGTTAATGAACAACACGCTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1674s21c1
Sequence:CCGGGTTTAAGCCCTATGTTATATTCTCGAGAATATAACATAGGGCTTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-337s21c1
Sequence:CCGGCATGAGAAACTCCGCTATTATCTCGAGATAATAGCGGAGTTTCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-306s21c1
Sequence:CCGGTGAGAAGAGCCTCAGTTATTTCTCGAGAAATAACTGAGGCTCTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-800s21c1
Sequence:CCGGCCCAATCCCAGGGATCCATTACTCGAGTAATGGATCCCTGGGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1174s21c1
Sequence:CCGGGGGTACTTTAAAGGACATTATCTCGAGATAATGTCCTTTAAAGTACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-507s1c1
Sequence:CCGGCCCGATAACATCGATGAGGATCTCGAGATCCTCATCGATGTTATCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-1755s1c1
Sequence:CCGGGCCTTCATAGATCAGCACTATCTCGAGATAGTGCTGATCTATGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-726s1c1
Sequence:CCGGCCAGACGAGATCAGCCAAATTCTCGAGAATTTGGCTGATCTCGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-1631s1c1
Sequence:CCGGGCCCTATGTTATATTTGTGAACTCGAGTTCACAAATATAACATAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-288s1c1
Sequence:CCGGCACGAGAAACTCCGCTATTATCTCGAGATAATAGCGGAGTTTCTCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007863
MPP3 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007863.2-2276s21c1
Sequence:CCGGTACCATGATGTTTCAGCTTTACTCGAGTAAAGCTGAAACATCATGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1542s21c1
Sequence:CCGGCCTGGAGCATGGAGAATATAACTCGAGTTATATTCTCCATGCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-775s21c1
Sequence:CCGGCCAGACGAGATCAGCCAAATTCTCGAGAATTTGGCTGATCTCGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007863.2-2163s21c1
Sequence:CCGGGAATAGCGTGTTGTTCATTAACTCGAGTTAATGAACAACACGCTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1674s21c1
Sequence:CCGGGTTTAAGCCCTATGTTATATTCTCGAGAATATAACATAGGGCTTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-337s21c1
Sequence:CCGGCATGAGAAACTCCGCTATTATCTCGAGATAATAGCGGAGTTTCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-306s21c1
Sequence:CCGGTGAGAAGAGCCTCAGTTATTTCTCGAGAAATAACTGAGGCTCTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-800s21c1
Sequence:CCGGCCCAATCCCAGGGATCCATTACTCGAGTAATGGATCCCTGGGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007863.2-1174s21c1
Sequence:CCGGGGGTACTTTAAAGGACATTATCTCGAGATAATGTCCTTTAAAGTACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-507s1c1
Sequence:CCGGCCCGATAACATCGATGAGGATCTCGAGATCCTCATCGATGTTATCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-1755s1c1
Sequence:CCGGGCCTTCATAGATCAGCACTATCTCGAGATAGTGCTGATCTATGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-726s1c1
Sequence:CCGGCCAGACGAGATCAGCCAAATTCTCGAGAATTTGGCTGATCTCGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-1631s1c1
Sequence:CCGGGCCCTATGTTATATTTGTGAACTCGAGTTCACAAATATAACATAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007863.1-288s1c1
Sequence:CCGGCACGAGAAACTCCGCTATTATCTCGAGATAATAGCGGAGTTTCTCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001932
VALIDATED
MPP3 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1036s21c1
Sequence:CCGGGTTCCAGGAGAGACGACTAAGCTCGAGCTTAGTCGTCTCTCCTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-314s21c1
Sequence:CCGGCATGAGAAGCTTCGCTATTATCTCGAGATAATAGCGAAGCTTCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1909s21c1
Sequence:CCGGTAGTTGGGTCAGGTAACTTTACTCGAGTAAAGTTACCTGACCCAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001932.3-2405s21c1
Sequence:CCGGGAAGTGCTTGCCTGGTAATAGCTCGAGCTATTACCAGGCAAGCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1780s21c1
Sequence:CCGGCGCCTTCATAGACCGGCATTACTCGAGTAATGCCGGTCTATGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-462s1c1
Sequence:CCGGCCTCAGTTACTTAATGAAGATCTCGAGATCTTCATTAAGTAACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-784s21c1
Sequence:CCGGCCAGGGATCCATCACCCTAAACTCGAGTTTAGGGTGATGGATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001932.2-1912s1c1
Sequence:CCGGCCATTTGATGAGCAGCAGCAACTCGAGTTGCTGCTGCTCATCAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-1654s1c1
Sequence:CCGGCAAGCATTTGAGGCCGACTTACTCGAGTAAGTCGGCCTCAAATGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-821s21c1
Sequence:CCGGCAGGAGGAAGATCGCTTAAAGCTCGAGCTTTAAGCGATCTTCCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001932.2-2747s1c1
Sequence:CCGGCCTTTCTAAATACCCTCAGATCTCGAGATCTGAGGGTATTTAGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-703s1c1
Sequence:CCGGCCTGACAATATCGATGAGGATCTCGAGATCCTCATCGATATTGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001932
VALIDATED
MPP3 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1036s21c1
Sequence:CCGGGTTCCAGGAGAGACGACTAAGCTCGAGCTTAGTCGTCTCTCCTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-314s21c1
Sequence:CCGGCATGAGAAGCTTCGCTATTATCTCGAGATAATAGCGAAGCTTCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1909s21c1
Sequence:CCGGTAGTTGGGTCAGGTAACTTTACTCGAGTAAAGTTACCTGACCCAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001932.3-2405s21c1
Sequence:CCGGGAAGTGCTTGCCTGGTAATAGCTCGAGCTATTACCAGGCAAGCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1780s21c1
Sequence:CCGGCGCCTTCATAGACCGGCATTACTCGAGTAATGCCGGTCTATGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-462s1c1
Sequence:CCGGCCTCAGTTACTTAATGAAGATCTCGAGATCTTCATTAAGTAACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-784s21c1
Sequence:CCGGCCAGGGATCCATCACCCTAAACTCGAGTTTAGGGTGATGGATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001932.2-1912s1c1
Sequence:CCGGCCATTTGATGAGCAGCAGCAACTCGAGTTGCTGCTGCTCATCAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-1654s1c1
Sequence:CCGGCAAGCATTTGAGGCCGACTTACTCGAGTAAGTCGGCCTCAAATGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-821s21c1
Sequence:CCGGCAGGAGGAAGATCGCTTAAAGCTCGAGCTTTAAGCGATCTTCCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001932.2-2747s1c1
Sequence:CCGGCCTTTCTAAATACCCTCAGATCTCGAGATCTGAGGGTATTTAGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-703s1c1
Sequence:CCGGCCTGACAATATCGATGAGGATCTCGAGATCCTCATCGATATTGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001932
VALIDATED
MPP3 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1036s21c1
Sequence:CCGGGTTCCAGGAGAGACGACTAAGCTCGAGCTTAGTCGTCTCTCCTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-314s21c1
Sequence:CCGGCATGAGAAGCTTCGCTATTATCTCGAGATAATAGCGAAGCTTCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1909s21c1
Sequence:CCGGTAGTTGGGTCAGGTAACTTTACTCGAGTAAAGTTACCTGACCCAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001932.3-2405s21c1
Sequence:CCGGGAAGTGCTTGCCTGGTAATAGCTCGAGCTATTACCAGGCAAGCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-1780s21c1
Sequence:CCGGCGCCTTCATAGACCGGCATTACTCGAGTAATGCCGGTCTATGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-462s1c1
Sequence:CCGGCCTCAGTTACTTAATGAAGATCTCGAGATCTTCATTAAGTAACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-784s21c1
Sequence:CCGGCCAGGGATCCATCACCCTAAACTCGAGTTTAGGGTGATGGATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001932.2-1912s1c1
Sequence:CCGGCCATTTGATGAGCAGCAGCAACTCGAGTTGCTGCTGCTCATCAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-1654s1c1
Sequence:CCGGCAAGCATTTGAGGCCGACTTACTCGAGTAAGTCGGCCTCAAATGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001932.3-821s21c1
Sequence:CCGGCAGGAGGAAGATCGCTTAAAGCTCGAGCTTTAAGCGATCTTCCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001932.2-2747s1c1
Sequence:CCGGCCTTTCTAAATACCCTCAGATCTCGAGATCTGAGGGTATTTAGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001932.2-703s1c1
Sequence:CCGGCCTGACAATATCGATGAGGATCTCGAGATCCTCATCGATATTGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)