EMAIL THIS PAGE TO A FRIEND

MPP4

membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)

68 Gene Product Result for
Synonyms: ALS2CR5 DLG6
UniProtKB ID: Q96JB8, C9IZK4, Q53TT3, Q6ZNH6, Q96Q43, Q96Q44
Gene ID:
Human(58538) Summary: This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) protein family, with an N-terminal PDZ domain, a central src homology 3 region (SH3), and a C-terminal guanylate kinase-like (GUK) domain. The protein is localized to the outer limiting membrane in the retina, and is thought to function in photoreceptor polarity and the organization of specialized intercellular junctions. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(227157) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Rat(58808) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
domestic guinea pig(100735887) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
naked mole-rat(101713132) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Domestic Rabbit(100349491) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
sheep(101109333) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
chicken(769757) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
dog(488477) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Horse(100066741) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
cow(532070) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
domestic cat(101086996) membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
APREST94176 PrEST Antigen MPP4 Prestige Antigens Powered by Atlas Antibodies New human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033066 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093061 MISSION® esiRNA esiRNA human MPP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033066 Rosetta Predictions human pricing
NM_021265 Rosetta Predictions rat pricing
NM_145143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070253 predicted 794
2 SASI_Hs01_00070254 predicted 1850
3 SASI_Hs02_00360765 predicted 437
4 SASI_Hs02_00360766 predicted 1546
5 SASI_Hs01_00070256 predicted 230
6 SASI_Hs01_00070257 predicted 1218
7 SASI_Hs01_00070258 predicted 1534
8 SASI_Hs01_00070259 predicted 1357
9 SASI_Hs01_00070260 predicted 1951
10 SASI_Hs01_00070261 predicted 1536
11 SASI_Hs01_00070255 predicted 1618
12 SASI_Hs01_00070262 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262581 predicted 1948
2 SASI_Rn02_00262582 predicted 231
3 SASI_Rn02_00262583 predicted 726
4 SASI_Rn02_00262584 predicted 895
5 SASI_Rn02_00262585 predicted 1672
6 SASI_Rn02_00262586 predicted 641
7 SASI_Rn02_00262587 predicted 1397
8 SASI_Rn02_00262588 predicted 313
9 SASI_Rn02_00262589 predicted 496
10 SASI_Rn02_00262590 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340541 predicted 563
2 SASI_Mm01_00174190 predicted 606
3 SASI_Mm01_00174192 predicted 1558
4 SASI_Mm01_00174194 predicted 1020
5 SASI_Mm02_00340542 predicted 355
6 SASI_Mm01_00174196 predicted 1771
7 SASI_Mm01_00174197 predicted 1514
8 SASI_Mm01_00174198 predicted 2012
9 SASI_Mm02_00340543 predicted 1488
10 SASI_Mm01_00174199 predicted 2113
11 SASI_Mm01_00174191 predicted 1595
12 SASI_Mm01_00174193 predicted 1681
13 SASI_Mm01_00174195 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145143
MPP4 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1624s1c1
Sequence:CCGGGCCCTGCGTTATATTTATTAACTCGAGTTAATAAATATAACGCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1486s1c1
Sequence:CCGGGCTGGAGTATGGTGAGTACAACTCGAGTTGTACTCACCATACTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1088s1c1
Sequence:CCGGGCAGAAGCTAAGGACGAATTTCTCGAGAAATTCGTCCTTAGCTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145143.3-1726s21c1
Sequence:CCGGACTTGAAGCCCTACGTTATATCTCGAGATATAACGTAGGGCTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-644s1c1
Sequence:CCGGCCTGAGCAAGTGATCCATATTCTCGAGAATATGGATCACTTGCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-913s1c1
Sequence:CCGGCCCTTCTAACCACCTTCTGAACTCGAGTTCAGAAGGTGGTTAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145143.3-854s21c1
Sequence:CCGGTGTTCGCGCCATGATTGATTACTCGAGTAATCAATCATGGCGCGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145143.3-2064s21c1
Sequence:CCGGTGCCCTAAAGATCCGGAATAACTCGAGTTATTCCGGATCTTTAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145143
MPP4 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1624s1c1
Sequence:CCGGGCCCTGCGTTATATTTATTAACTCGAGTTAATAAATATAACGCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1486s1c1
Sequence:CCGGGCTGGAGTATGGTGAGTACAACTCGAGTTGTACTCACCATACTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1088s1c1
Sequence:CCGGGCAGAAGCTAAGGACGAATTTCTCGAGAAATTCGTCCTTAGCTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145143.3-1726s21c1
Sequence:CCGGACTTGAAGCCCTACGTTATATCTCGAGATATAACGTAGGGCTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-644s1c1
Sequence:CCGGCCTGAGCAAGTGATCCATATTCTCGAGAATATGGATCACTTGCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-913s1c1
Sequence:CCGGCCCTTCTAACCACCTTCTGAACTCGAGTTCAGAAGGTGGTTAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145143.3-854s21c1
Sequence:CCGGTGTTCGCGCCATGATTGATTACTCGAGTAATCAATCATGGCGCGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145143.3-2064s21c1
Sequence:CCGGTGCCCTAAAGATCCGGAATAACTCGAGTTATTCCGGATCTTTAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145143
MPP4 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1624s1c1
Sequence:CCGGGCCCTGCGTTATATTTATTAACTCGAGTTAATAAATATAACGCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1486s1c1
Sequence:CCGGGCTGGAGTATGGTGAGTACAACTCGAGTTGTACTCACCATACTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-1088s1c1
Sequence:CCGGGCAGAAGCTAAGGACGAATTTCTCGAGAAATTCGTCCTTAGCTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145143.3-1726s21c1
Sequence:CCGGACTTGAAGCCCTACGTTATATCTCGAGATATAACGTAGGGCTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-644s1c1
Sequence:CCGGCCTGAGCAAGTGATCCATATTCTCGAGAATATGGATCACTTGCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145143.1-913s1c1
Sequence:CCGGCCCTTCTAACCACCTTCTGAACTCGAGTTCAGAAGGTGGTTAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145143.3-854s21c1
Sequence:CCGGTGTTCGCGCCATGATTGATTACTCGAGTAATCAATCATGGCGCGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145143.3-2064s21c1
Sequence:CCGGTGCCCTAAAGATCCGGAATAACTCGAGTTATTCCGGATCTTTAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033066
MPP4 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033066.1-2169s1c1
Sequence:CCGGGCGATCCATAGTTGCAATCTACTCGAGTAGATTGCAACTATGGATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033066.1-2170s1c1
Sequence:CCGGCGATCCATAGTTGCAATCTAACTCGAGTTAGATTGCAACTATGGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1846s1c1
Sequence:CCGGGCCATCGAATATGAGGTGTATCTCGAGATACACCTCATATTCGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-845s1c1
Sequence:CCGGCCTGAACAAGTGATCCATATTCTCGAGAATATGGATCACTTGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1666s1c1
Sequence:CCGGCCTCATATATAGTCACAGGATCTCGAGATCCTGTGACTATATATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-2100s1c1
Sequence:CCGGCCTCAGATACTGAGTCTCAATCTCGAGATTGAGACTCAGTATCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-583s1c1
Sequence:CCGGCCATGACACGATAGCTCAGAACTCGAGTTCTGAGCTATCGTGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-316s1c1
Sequence:CCGGGCAAGAGCTGAGTCTGTTCTACTCGAGTAGAACAGACTCAGCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1586s1c1
Sequence:CCGGCCACACACTACTCGTACTAAACTCGAGTTTAGTACGAGTAGTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-584s1c1
Sequence:CCGGCATGACACGATAGCTCAGAAACTCGAGTTTCTGAGCTATCGTGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033066
MPP4 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033066.1-2169s1c1
Sequence:CCGGGCGATCCATAGTTGCAATCTACTCGAGTAGATTGCAACTATGGATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033066.1-2170s1c1
Sequence:CCGGCGATCCATAGTTGCAATCTAACTCGAGTTAGATTGCAACTATGGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1846s1c1
Sequence:CCGGGCCATCGAATATGAGGTGTATCTCGAGATACACCTCATATTCGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-845s1c1
Sequence:CCGGCCTGAACAAGTGATCCATATTCTCGAGAATATGGATCACTTGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1666s1c1
Sequence:CCGGCCTCATATATAGTCACAGGATCTCGAGATCCTGTGACTATATATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-2100s1c1
Sequence:CCGGCCTCAGATACTGAGTCTCAATCTCGAGATTGAGACTCAGTATCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-583s1c1
Sequence:CCGGCCATGACACGATAGCTCAGAACTCGAGTTCTGAGCTATCGTGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-316s1c1
Sequence:CCGGGCAAGAGCTGAGTCTGTTCTACTCGAGTAGAACAGACTCAGCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1586s1c1
Sequence:CCGGCCACACACTACTCGTACTAAACTCGAGTTTAGTACGAGTAGTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-584s1c1
Sequence:CCGGCATGACACGATAGCTCAGAAACTCGAGTTTCTGAGCTATCGTGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033066
MPP4 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033066.1-2169s1c1
Sequence:CCGGGCGATCCATAGTTGCAATCTACTCGAGTAGATTGCAACTATGGATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033066.1-2170s1c1
Sequence:CCGGCGATCCATAGTTGCAATCTAACTCGAGTTAGATTGCAACTATGGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1846s1c1
Sequence:CCGGGCCATCGAATATGAGGTGTATCTCGAGATACACCTCATATTCGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-845s1c1
Sequence:CCGGCCTGAACAAGTGATCCATATTCTCGAGAATATGGATCACTTGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1666s1c1
Sequence:CCGGCCTCATATATAGTCACAGGATCTCGAGATCCTGTGACTATATATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-2100s1c1
Sequence:CCGGCCTCAGATACTGAGTCTCAATCTCGAGATTGAGACTCAGTATCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-583s1c1
Sequence:CCGGCCATGACACGATAGCTCAGAACTCGAGTTCTGAGCTATCGTGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-316s1c1
Sequence:CCGGGCAAGAGCTGAGTCTGTTCTACTCGAGTAGAACAGACTCAGCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-1586s1c1
Sequence:CCGGCCACACACTACTCGTACTAAACTCGAGTTTAGTACGAGTAGTGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033066.1-584s1c1
Sequence:CCGGCATGACACGATAGCTCAGAAACTCGAGTTTCTGAGCTATCGTGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)