EMAIL THIS PAGE TO A FRIEND

MPP5

membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)

135 Gene Product Result for
Synonyms: PALS1
UniProtKB ID: Q8N3R9, A1L380, Q7Z631, Q86T98, Q8N7I5, Q9H9Q0
Gene ID:
Human(64398) Summary: This gene encodes a member of the p55-like subfamily of the membrane-associated guanylate kinase (MAGUK) gene superfamily. The encoded protein participates in the polarization of differentiating cells, has been shown to regulate myelinating Schwann cells (PMID: 20237282), and is one of the components of the Crumbs complex in the retina. Mice which express lower levels of the orthologous protein have retinal degeneration and impaired vision (PMID: 22114289). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(56217) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Rat(314259) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
chicken(423281) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
cow(528109) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Horse(100052602) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
domestic cat(101090946) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
dog(490740) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
sheep(101113152) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
naked mole-rat(101724481) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
domestic guinea pig(100715808) membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022474 Rosetta Predictions human pricing
NM_001108034 Rosetta Predictions rat pricing
NM_019579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215227 predicted 695
2 SASI_Hs01_00215228 predicted 1623
3 SASI_Hs01_00215229 predicted 2096
4 SASI_Hs01_00215231 predicted 1000
5 SASI_Hs02_00355752 predicted 1393
6 SASI_Hs01_00215233 predicted 1543
7 SASI_Hs01_00215234 predicted 1283
8 SASI_Hs01_00215235 predicted 863
9 SASI_Hs01_00215236 predicted 1886
10 SASI_Hs02_00355753 predicted 2359
11 SASI_Hs01_00215230 predicted 2566
12 SASI_Hs01_00215232 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234715 predicted 1376
2 SASI_Rn02_00234716 predicted 483
3 SASI_Rn02_00234717 predicted 1065
4 SASI_Rn02_00234718 predicted 279
5 SASI_Rn02_00234719 predicted 506
6 SASI_Rn02_00234720 predicted 503
7 SASI_Rn02_00234721 predicted 1441
8 SASI_Rn02_00234722 predicted 2084
9 SASI_Rn02_00234723 predicted 251
10 SASI_Rn02_00234724 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136853 predicted 569
2 SASI_Mm01_00136854 predicted 501
3 SASI_Mm01_00136855 predicted 1415
4 SASI_Mm01_00136856 predicted 598
5 SASI_Mm01_00136857 predicted 1455
6 SASI_Mm01_00136858 predicted 618
7 SASI_Mm01_00136859 predicted 1497
8 SASI_Mm01_00136860 predicted 2426
9 SASI_Mm01_00136861 predicted 373
10 SASI_Mm01_00136862 predicted 2247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019579
MPP5 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-2018s21c1
Sequence:CCGGAGACTCTGTACGACAAGTAATCTCGAGATTACTTGTCGTACAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-2100s21c1
Sequence:CCGGTCAGATTTGAAACCATATATCCTCGAGGATATATGGTTTCAAATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-374s21c1
Sequence:CCGGGGAATCAGACAGCGGAATAAACTCGAGTTTATTCCGCTGTCTGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-629s21c1
Sequence:CCGGTGGAATAGATAACCCTATATTCTCGAGAATATAGGGTTATCTATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-1962s1c1
Sequence:CCGGGCTGGCAAGTTCATTGAACATCTCGAGATGTTCAATGAACTTGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-690s1c1
Sequence:CCGGGCTGTGAACATATTAGACGTTCTCGAGAACGTCTAATATGTTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-1908s1c1
Sequence:CCGGGCTGGGAGAGATTACCACTTTCTCGAGAAAGTGGTAATCTCTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-873s1c1
Sequence:CCGGCCGTTTCCTCTTATCGCCAATCTCGAGATTGGCGATAAGAGGAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-2133s1c1
Sequence:CCGGCCACCTTCACAAGAGAGACTTCTCGAGAAGTCTCTCTTGTGAAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019579
MPP5 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-2018s21c1
Sequence:CCGGAGACTCTGTACGACAAGTAATCTCGAGATTACTTGTCGTACAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-2100s21c1
Sequence:CCGGTCAGATTTGAAACCATATATCCTCGAGGATATATGGTTTCAAATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-374s21c1
Sequence:CCGGGGAATCAGACAGCGGAATAAACTCGAGTTTATTCCGCTGTCTGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-629s21c1
Sequence:CCGGTGGAATAGATAACCCTATATTCTCGAGAATATAGGGTTATCTATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-1962s1c1
Sequence:CCGGGCTGGCAAGTTCATTGAACATCTCGAGATGTTCAATGAACTTGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-690s1c1
Sequence:CCGGGCTGTGAACATATTAGACGTTCTCGAGAACGTCTAATATGTTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-1908s1c1
Sequence:CCGGGCTGGGAGAGATTACCACTTTCTCGAGAAAGTGGTAATCTCTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-873s1c1
Sequence:CCGGCCGTTTCCTCTTATCGCCAATCTCGAGATTGGCGATAAGAGGAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-2133s1c1
Sequence:CCGGCCACCTTCACAAGAGAGACTTCTCGAGAAGTCTCTCTTGTGAAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019579
MPP5 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-2018s21c1
Sequence:CCGGAGACTCTGTACGACAAGTAATCTCGAGATTACTTGTCGTACAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-2100s21c1
Sequence:CCGGTCAGATTTGAAACCATATATCCTCGAGGATATATGGTTTCAAATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-374s21c1
Sequence:CCGGGGAATCAGACAGCGGAATAAACTCGAGTTTATTCCGCTGTCTGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019579.1-629s21c1
Sequence:CCGGTGGAATAGATAACCCTATATTCTCGAGAATATAGGGTTATCTATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-1962s1c1
Sequence:CCGGGCTGGCAAGTTCATTGAACATCTCGAGATGTTCAATGAACTTGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-690s1c1
Sequence:CCGGGCTGTGAACATATTAGACGTTCTCGAGAACGTCTAATATGTTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-1908s1c1
Sequence:CCGGGCTGGGAGAGATTACCACTTTCTCGAGAAAGTGGTAATCTCTCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-873s1c1
Sequence:CCGGCCGTTTCCTCTTATCGCCAATCTCGAGATTGGCGATAAGAGGAAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019579.1-2133s1c1
Sequence:CCGGCCACCTTCACAAGAGAGACTTCTCGAGAAGTCTCTCTTGTGAAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022474
MPP5 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022474.2-1718s21c1
Sequence:CCGGGCCATGAAACAAACCATAGAACTCGAGTTCTATGGTTTGTTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022474.2-3046s21c1
Sequence:CCGGGCTACTTTGTTAGGCTTGAATCTCGAGATTCAAGCCTAACAAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022474.2-3971s21c1
Sequence:CCGGCCCAGAGCTAAACACTGGAATCTCGAGATTCCAGTGTTTAGCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022474.2-757s21c1
Sequence:CCGGCGGAATAGATAACCCTATGTTCTCGAGAACATAGGGTTATCTATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-3971s1c1
Sequence:CCGGCCCAGAGCTAAACACTGGAATCTCGAGATTCCAGTGTTTAGCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-3046s1c1
Sequence:CCGGGCTACTTTGTTAGGCTTGAATCTCGAGATTCAAGCCTAACAAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-5201s1c1
Sequence:CCGGGCAGGGATTTAGCCTTAATAACTCGAGTTATTAAGGCTAAATCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022474.2-757s1c1
Sequence:CCGGCGGAATAGATAACCCTATGTTCTCGAGAACATAGGGTTATCTATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022474.2-1860s1c1
Sequence:CCGGCCTATGAGGAAATGTCACTTTCTCGAGAAAGTGACATTTCCTCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022474.2-1718s1c1
Sequence:CCGGGCCATGAAACAAACCATAGAACTCGAGTTCTATGGTTTGTTTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022474.2-1095s1c1
Sequence:CCGGCTTTGCTGAATACTCCACATACTCGAGTATGTGGAGTATTCAGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022474
MPP5 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022474.2-1718s21c1
Sequence:CCGGGCCATGAAACAAACCATAGAACTCGAGTTCTATGGTTTGTTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022474.2-3046s21c1
Sequence:CCGGGCTACTTTGTTAGGCTTGAATCTCGAGATTCAAGCCTAACAAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022474.2-3971s21c1
Sequence:CCGGCCCAGAGCTAAACACTGGAATCTCGAGATTCCAGTGTTTAGCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022474.2-757s21c1
Sequence:CCGGCGGAATAGATAACCCTATGTTCTCGAGAACATAGGGTTATCTATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-3971s1c1
Sequence:CCGGCCCAGAGCTAAACACTGGAATCTCGAGATTCCAGTGTTTAGCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-3046s1c1
Sequence:CCGGGCTACTTTGTTAGGCTTGAATCTCGAGATTCAAGCCTAACAAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-5201s1c1
Sequence:CCGGGCAGGGATTTAGCCTTAATAACTCGAGTTATTAAGGCTAAATCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022474.2-757s1c1
Sequence:CCGGCGGAATAGATAACCCTATGTTCTCGAGAACATAGGGTTATCTATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022474.2-1860s1c1
Sequence:CCGGCCTATGAGGAAATGTCACTTTCTCGAGAAAGTGACATTTCCTCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022474.2-1718s1c1
Sequence:CCGGGCCATGAAACAAACCATAGAACTCGAGTTCTATGGTTTGTTTCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022474.2-1095s1c1
Sequence:CCGGCTTTGCTGAATACTCCACATACTCGAGTATGTGGAGTATTCAGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022474
MPP5 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022474.2-1718s21c1
Sequence:CCGGGCCATGAAACAAACCATAGAACTCGAGTTCTATGGTTTGTTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022474.2-3046s21c1
Sequence:CCGGGCTACTTTGTTAGGCTTGAATCTCGAGATTCAAGCCTAACAAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022474.2-3971s21c1
Sequence:CCGGCCCAGAGCTAAACACTGGAATCTCGAGATTCCAGTGTTTAGCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022474.2-757s21c1
Sequence:CCGGCGGAATAGATAACCCTATGTTCTCGAGAACATAGGGTTATCTATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-3971s1c1
Sequence:CCGGCCCAGAGCTAAACACTGGAATCTCGAGATTCCAGTGTTTAGCTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-3046s1c1
Sequence:CCGGGCTACTTTGTTAGGCTTGAATCTCGAGATTCAAGCCTAACAAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022474.2-5201s1c1
Sequence:CCGGGCAGGGATTTAGCCTTAATAACTCGAGTTATTAAGGCTAAATCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022474.2-757s1c1
Sequence:CCGGCGGAATAGATAACCCTATGTTCTCGAGAACATAGGGTTATCTATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022474.2-1860s1c1
Sequence:CCGGCCTATGAGGAAATGTCACTTTCTCGAGAAAGTGACATTTCCTCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022474.2-1718s1c1
Sequence:CCGGGCCATGAAACAAACCATAGAACTCGAGTTCTATGGTTTGTTTCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022474.2-1095s1c1
Sequence:CCGGCTTTGCTGAATACTCCACATACTCGAGTATGTGGAGTATTCAGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)