EMAIL THIS PAGE TO A FRIEND

MPP6

membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)

72 Gene Product Result for
Synonyms: PALS2 VAM-1 VAM1 p55T
UniProtKB ID: Q9NZW5, A4D157, Q9H0E1
Gene ID:
Human(51678) Summary: Members of the peripheral membrane-associated guanylate kinase (MAGUK) family function in tumor suppression and receptor clustering by forming multiprotein complexes containing distinct sets of transmembrane, cytoskeletal, and cytoplasmic signaling proteins. All MAGUKs contain a PDZ-SH3-GUK core and are divided into 4 subfamilies, DLG-like (see DLG1; MIM 601014), ZO1-like (see TJP1; MIM 601009), p55-like (see MPP1; MIM 305360), and LIN2-like (see CASK; MIM 300172), based on their size and the presence of additional domains. MPP6 is a member of the p55-like MAGUK subfamily (Tseng et al., 2001 [PubMed 11311936]
Mouse(56524) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Rat(362359) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
fruit fly(35382) M-phase phosphoprotein 6
chicken(420622) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
domestic cat(101097224) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
cow(535171) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Horse(100068339) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
dog(482362) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
domestic guinea pig(100726193) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
naked mole-rat(101719437) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Domestic Rabbit(100339734) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
sheep(101109532) membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016447 Rosetta Predictions human pricing
NM_001134982 Rosetta Predictions rat pricing
NM_019939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349480 predicted 408
2 SASI_Hs01_00054464 predicted 1900
3 SASI_Hs01_00054465 predicted 370
4 SASI_Hs01_00054466 predicted 1559
5 SASI_Hs01_00054467 predicted 924
6 SASI_Hs01_00054468 predicted 905
7 SASI_Hs01_00054469 predicted 1854
8 SASI_Hs01_00054470 predicted 1576
9 SASI_Hs01_00054471 predicted 1719
10 SASI_Hs02_00349481 predicted 531
11 SASI_Hs01_00054462 predicted 859
12 SASI_Hs01_00054463 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259224 predicted 652
2 SASI_Rn02_00259225 predicted 419
3 SASI_Rn02_00259226 predicted 1608
4 SASI_Rn02_00259227 predicted 919
5 SASI_Rn02_00259228 predicted 520
6 SASI_Rn02_00259229 predicted 288
7 SASI_Rn02_00259230 predicted 1161
8 SASI_Rn02_00259231 predicted 1146
9 SASI_Rn02_00259232 predicted 237
10 SASI_Rn02_00259233 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325233 predicted 614
2 SASI_Mm01_00146221 predicted 522
3 SASI_Mm01_00146222 predicted 1572
4 SASI_Mm01_00146223 predicted 763
5 SASI_Mm01_00146224 predicted 1760
6 SASI_Mm01_00146225 predicted 849
7 SASI_Mm01_00146226 predicted 1750
8 SASI_Mm02_00325234 predicted 885
9 SASI_Mm01_00146228 predicted 1127
10 SASI_Mm01_00146229 predicted 1496
11 SASI_Mm01_00146227 predicted 1665
12 SASI_Mm01_00146230 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019939
VALIDATED
MPP6 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-532s1c1
Sequence:CCGGGCCATCCGTATTCTCGGTATTCTCGAGAATACCGAGAATACGGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-205s1c1
Sequence:CCGGGCAGAGGAGATAGACCTAATTCTCGAGAATTAGGTCTATCTCCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-361s1c1
Sequence:CCGGCCTCTGATTAGTGTGGATGAACTCGAGTTCATCCACACTAATCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-1648s1c1
Sequence:CCGGGCATACAACCACTACTTTGATCTCGAGATCAAAGTAGTGGTTGTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-927s21c1
Sequence:CCGGTTACTCCTCAGCAGGTATTTGCTCGAGCAAATACCTGCTGAGGAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-795s21c1
Sequence:CCGGTTCACGTGGGAGATATCATTACTCGAGTAATGATATCTCCCACGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-1467s21c1
Sequence:CCGGCAGAGATGGAAGCAGATATTACTCGAGTAATATCTGCTTCCATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-1367s21c1
Sequence:CCGGGTACTGAATCCTGCTAGATTTCTCGAGAAATCTAGCAGGATTCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019939
VALIDATED
MPP6 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-532s1c1
Sequence:CCGGGCCATCCGTATTCTCGGTATTCTCGAGAATACCGAGAATACGGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-205s1c1
Sequence:CCGGGCAGAGGAGATAGACCTAATTCTCGAGAATTAGGTCTATCTCCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-361s1c1
Sequence:CCGGCCTCTGATTAGTGTGGATGAACTCGAGTTCATCCACACTAATCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-1648s1c1
Sequence:CCGGGCATACAACCACTACTTTGATCTCGAGATCAAAGTAGTGGTTGTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-927s21c1
Sequence:CCGGTTACTCCTCAGCAGGTATTTGCTCGAGCAAATACCTGCTGAGGAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-795s21c1
Sequence:CCGGTTCACGTGGGAGATATCATTACTCGAGTAATGATATCTCCCACGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-1467s21c1
Sequence:CCGGCAGAGATGGAAGCAGATATTACTCGAGTAATATCTGCTTCCATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-1367s21c1
Sequence:CCGGGTACTGAATCCTGCTAGATTTCTCGAGAAATCTAGCAGGATTCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019939
VALIDATED
MPP6 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-532s1c1
Sequence:CCGGGCCATCCGTATTCTCGGTATTCTCGAGAATACCGAGAATACGGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-205s1c1
Sequence:CCGGGCAGAGGAGATAGACCTAATTCTCGAGAATTAGGTCTATCTCCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-361s1c1
Sequence:CCGGCCTCTGATTAGTGTGGATGAACTCGAGTTCATCCACACTAATCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019939.1-1648s1c1
Sequence:CCGGGCATACAACCACTACTTTGATCTCGAGATCAAAGTAGTGGTTGTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-927s21c1
Sequence:CCGGTTACTCCTCAGCAGGTATTTGCTCGAGCAAATACCTGCTGAGGAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-795s21c1
Sequence:CCGGTTCACGTGGGAGATATCATTACTCGAGTAATGATATCTCCCACGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-1467s21c1
Sequence:CCGGCAGAGATGGAAGCAGATATTACTCGAGTAATATCTGCTTCCATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019939.2-1367s21c1
Sequence:CCGGGTACTGAATCCTGCTAGATTTCTCGAGAAATCTAGCAGGATTCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016447
VALIDATED
MPP6 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-528s1c1
Sequence:CCGGGTGGCAGAATTGGTTGGTATACTCGAGTATACCAACCAATTCTGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-1158s1c1
Sequence:CCGGGTTAGAAGAGACTGGGACAATCTCGAGATTGTCCCAGTCTCTTCTAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016447.x-1968s1c1
Sequence:CCGGCTGCAACAAATAAACCTTCTACTCGAGTAGAAGGTTTATTTGTTGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016447.2-1924s21c1
Sequence:GTACCGGGATTCAGTAAGGTTAACAATGCTCGAGCATTGTTAACCTTACTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-936s21c1
Sequence:GTACCGGATTACTCCTCAACAGGTATTTCTCGAGAAATACCTGTTGAGGAGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016447.x-527s1c1
Sequence:CCGGTGTGGCAGAATTGGTTGGTATCTCGAGATACCAACCAATTCTGCCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-617s1c1
Sequence:CCGGACCTCCATCAAGCCCAGAAATCTCGAGATTTCTGGGCTTGATGGAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-617s21c1
Sequence:CCGGACCTCCATCAAGCCCAGAAATCTCGAGATTTCTGGGCTTGATGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016447.2-2000s21c1
Sequence:CCGGCATCACAGATAGAAGATTATCCTCGAGGATAATCTTCTATCTGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-1158s21c1
Sequence:CCGGGTTAGAAGAGACTGGGACAATCTCGAGATTGTCCCAGTCTCTTCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-802s21c1
Sequence:CCGGTACTTCATGTGGGAGATATAACTCGAGTTATATCTCCCACATGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-528s21c1
Sequence:CCGGGTGGCAGAATTGGTTGGTATACTCGAGTATACCAACCAATTCTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016447
VALIDATED
MPP6 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-528s1c1
Sequence:CCGGGTGGCAGAATTGGTTGGTATACTCGAGTATACCAACCAATTCTGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-1158s1c1
Sequence:CCGGGTTAGAAGAGACTGGGACAATCTCGAGATTGTCCCAGTCTCTTCTAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016447.x-1968s1c1
Sequence:CCGGCTGCAACAAATAAACCTTCTACTCGAGTAGAAGGTTTATTTGTTGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016447.2-1924s21c1
Sequence:GTACCGGGATTCAGTAAGGTTAACAATGCTCGAGCATTGTTAACCTTACTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-936s21c1
Sequence:GTACCGGATTACTCCTCAACAGGTATTTCTCGAGAAATACCTGTTGAGGAGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016447.x-527s1c1
Sequence:CCGGTGTGGCAGAATTGGTTGGTATCTCGAGATACCAACCAATTCTGCCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-617s1c1
Sequence:CCGGACCTCCATCAAGCCCAGAAATCTCGAGATTTCTGGGCTTGATGGAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-617s21c1
Sequence:CCGGACCTCCATCAAGCCCAGAAATCTCGAGATTTCTGGGCTTGATGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016447.2-2000s21c1
Sequence:CCGGCATCACAGATAGAAGATTATCCTCGAGGATAATCTTCTATCTGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-1158s21c1
Sequence:CCGGGTTAGAAGAGACTGGGACAATCTCGAGATTGTCCCAGTCTCTTCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-802s21c1
Sequence:CCGGTACTTCATGTGGGAGATATAACTCGAGTTATATCTCCCACATGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-528s21c1
Sequence:CCGGGTGGCAGAATTGGTTGGTATACTCGAGTATACCAACCAATTCTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016447
VALIDATED
MPP6 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-528s1c1
Sequence:CCGGGTGGCAGAATTGGTTGGTATACTCGAGTATACCAACCAATTCTGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-1158s1c1
Sequence:CCGGGTTAGAAGAGACTGGGACAATCTCGAGATTGTCCCAGTCTCTTCTAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016447.x-1968s1c1
Sequence:CCGGCTGCAACAAATAAACCTTCTACTCGAGTAGAAGGTTTATTTGTTGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016447.2-1924s21c1
Sequence:GTACCGGGATTCAGTAAGGTTAACAATGCTCGAGCATTGTTAACCTTACTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-936s21c1
Sequence:GTACCGGATTACTCCTCAACAGGTATTTCTCGAGAAATACCTGTTGAGGAGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016447.x-527s1c1
Sequence:CCGGTGTGGCAGAATTGGTTGGTATCTCGAGATACCAACCAATTCTGCCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016447.x-617s1c1
Sequence:CCGGACCTCCATCAAGCCCAGAAATCTCGAGATTTCTGGGCTTGATGGAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-617s21c1
Sequence:CCGGACCTCCATCAAGCCCAGAAATCTCGAGATTTCTGGGCTTGATGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016447.2-2000s21c1
Sequence:CCGGCATCACAGATAGAAGATTATCCTCGAGGATAATCTTCTATCTGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-1158s21c1
Sequence:CCGGGTTAGAAGAGACTGGGACAATCTCGAGATTGTCCCAGTCTCTTCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-802s21c1
Sequence:CCGGTACTTCATGTGGGAGATATAACTCGAGTTATATCTCCCACATGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016447.2-528s21c1
Sequence:CCGGGTGGCAGAATTGGTTGGTATACTCGAGTATACCAACCAATTCTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)