EMAIL THIS PAGE TO A FRIEND

MPP7

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

194 Gene Product Result for
UniProtKB ID: Q5T2T1, B2RCC9, B5MDZ3, D3DRW3, Q5T2T0, Q8IY28
Gene ID:
Human(143098) Summary: Membrane-associated guanylate kinases (MAGUKs) are important adaptor proteins involved in the assembly of protein complexes at sites of cell-cell contact. They are found in synapses, adherens junctions, and tight junctions. All MAGUKs contain at least 1 PDZ domain, an SH3 domain, and a GUK domain, and many contain 1 or 2 L27 domains, which are involved in multimerization of MAGUKs. MPP7 belongs to the p55 stardust subfamily of MAGUKs, which is named for a Drosophila gene required for establishment of cell polarity in the developing fly embryo (Bohl et al., 2007 [PubMed 17237226]
Mouse(75739) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Rat(307035) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Zebrafish(30166) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
chicken(420481) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
dog(487080) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Horse(100064840) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
cow(512659) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
domestic cat(101089112) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
sheep(101120006) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
naked mole-rat(101699892) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
domestic guinea pig(100723359) membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173496 Rosetta Predictions human pricing
XM_001061023 Rosetta Predictions rat pricing
XM_001061081 Rosetta Predictions rat pricing
XM_225473 Rosetta Predictions rat pricing
NM_001081287 Rosetta Predictions mouse pricing
XM_128966 Rosetta Predictions mouse pricing
XM_885755 Rosetta Predictions mouse pricing
XM_896325 Rosetta Predictions mouse pricing
XM_896336 Rosetta Predictions mouse pricing
XM_896352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221208 predicted 769
2 SASI_Hs01_00221209 predicted 920
3 SASI_Hs02_00368263 predicted 734
4 SASI_Hs02_00368264 predicted 2223
5 SASI_Hs02_00368265 predicted 645
6 SASI_Hs01_00221215 predicted 1417
7 SASI_Hs01_00221216 predicted 847
8 SASI_Hs02_00368266 predicted 2140
9 SASI_Hs01_00221217 predicted 965
10 SASI_Hs02_00368267 predicted 1291
11 SASI_Hs01_00221210 predicted 1513
12 SASI_Hs01_00221211 predicted 1063
13 SASI_Hs01_00221212 predicted 1232
14 SASI_Hs01_00221213 predicted 495
15 SASI_Hs01_00221214 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298498 predicted 1127
2 SASI_Rn02_00298499 predicted 1708
3 SASI_Rn02_00298500 predicted 711
4 SASI_Rn02_00298501 predicted 1327
5 SASI_Rn02_00298502 predicted 654
6 SASI_Rn02_00298503 predicted 358
7 SASI_Rn02_00298504 predicted 809
8 SASI_Rn02_00298505 predicted 764
9 SASI_Rn02_00298506 predicted 1510
10 SASI_Rn02_00298507 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298724 predicted 1188
2 SASI_Rn02_00298725 predicted 1760
3 SASI_Rn02_00298726 predicted 778
4 SASI_Rn02_00298727 predicted 1380
5 SASI_Rn02_00298728 predicted 706
6 SASI_Rn02_00298729 predicted 418
7 SASI_Rn02_00298730 predicted 865
8 SASI_Rn02_00298731 predicted 818
9 SASI_Rn02_00298732 predicted 1570
10 SASI_Rn02_00298733 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139987 predicted 1189
2 SASI_Rn01_00139988 predicted 777
3 SASI_Rn01_00139989 predicted 1159
4 SASI_Rn01_00139990 predicted 711
5 SASI_Rn01_00139991 predicted 420
6 SASI_Rn01_00139992 predicted 900
7 SASI_Rn01_00139993 predicted 865
8 SASI_Rn01_00139994 predicted 817
9 SASI_Rn01_00139995 predicted 670
10 SASI_Rn01_00139996 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296991 predicted 910
2 SASI_Mm02_00296992 predicted 757
3 SASI_Mm02_00296993 predicted 721
4 SASI_Mm02_00296994 predicted 1163
5 SASI_Mm02_00296995 predicted 496
6 SASI_Mm02_00296996 predicted 795
7 SASI_Mm02_00296997 predicted 1022
8 SASI_Mm02_00296998 predicted 767
9 SASI_Mm02_00296999 predicted 876
10 SASI_Mm02_00297000 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230794 predicted 921
2 SASI_Mm01_00230795 predicted 755
3 SASI_Mm01_00230796 predicted 913
4 SASI_Mm01_00230797 predicted 718
5 SASI_Mm01_00230798 predicted 1164
6 SASI_Mm01_00230799 predicted 500
7 SASI_Mm01_00230800 predicted 1022
8 SASI_Mm01_00230801 predicted 770
9 SASI_Mm01_00230802 predicted 884
10 SASI_Mm01_00230803 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213191 predicted 921
2 SASI_Mm01_00213192 predicted 755
3 SASI_Mm01_00213193 predicted 722
4 SASI_Mm01_00213194 predicted 1164
5 SASI_Mm01_00213195 predicted 503
6 SASI_Mm01_00213196 predicted 803
7 SASI_Mm01_00213197 predicted 1027
8 SASI_Mm01_00213198 predicted 773
9 SASI_Mm01_00213199 predicted 889
10 SASI_Mm01_00213200 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255886 predicted 554
2 SASI_Mm01_00255887 predicted 522
3 SASI_Mm01_00255888 predicted 381
4 SASI_Mm01_00255889 predicted 381
5 SASI_Mm01_00255890 predicted 499
6 SASI_Mm01_00255891 predicted 557
7 SASI_Mm01_00255892 predicted 455
8 SASI_Mm01_00255893 predicted 506
9 SASI_Mm01_00255894 predicted 374
10 SASI_Mm01_00255895 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237436 predicted 912
2 SASI_Mm01_00237437 predicted 1177
3 SASI_Mm01_00237438 predicted 759
4 SASI_Mm01_00237439 predicted 721
5 SASI_Mm01_00237440 predicted 500
6 SASI_Mm01_00237441 predicted 1170
7 SASI_Mm01_00237442 predicted 798
8 SASI_Mm01_00237443 predicted 1024
9 SASI_Mm01_00237444 predicted 766
10 SASI_Mm01_00237445 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235692 predicted 912
2 SASI_Mm01_00235693 predicted 755
3 SASI_Mm01_00235694 predicted 715
4 SASI_Mm01_00235695 predicted 1169
5 SASI_Mm01_00235696 predicted 502
6 SASI_Mm01_00235697 predicted 1471
7 SASI_Mm01_00235698 predicted 797
8 SASI_Mm01_00235699 predicted 1024
9 SASI_Mm01_00235700 predicted 1400
10 SASI_Mm01_00235701 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173496
VALIDATED
MPP7 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-2111s21c1
Sequence:GTACCGGGCCAGTGAGCTGGTTACATTCCTCGAGGAATGTAACCAGCTCACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173496.3-1869s21c1
Sequence:CCGGCCATCAATAGAGCGTTTGAGACTCGAGTCTCAAACGCTCTATTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-845s21c1
Sequence:CCGGACCACTGGGAGCTACCATTAACTCGAGTTAATGGTAGCTCCCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-2509s21c1
Sequence:CCGGTAGCTGTTGAAGGTATCAATTCTCGAGAATTGATACCTTCAACAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-1732s21c1
Sequence:CCGGACTACTACGGCACAAGTATAGCTCGAGCTATACTTGTGCCGTAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-1544s21c1
Sequence:CCGGGCTGAATGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-610s1c1
Sequence:CCGGCAAGCCATTAAACAGTGAGATCTCGAGATCTCACTGTTTAATGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-1820s1c1
Sequence:CCGGCCATCAATAGAGCGTTTGAGACTCGAGTCTCAAACGCTCTATTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-493s1c1
Sequence:CCGGCCTGCATTCATTGGTAAAGATCTCGAGATCTTTACCAATGAATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-1495s1c1
Sequence:CCGGGCTGAATGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173496.2-947s1c1
Sequence:CCGGCCTGAGGAAATAATACAGATTCTCGAGAATCTGTATTATTTCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173496.2-492s1c1
Sequence:CCGGGCCTGCATTCATTGGTAAAGACTCGAGTCTTTACCAATGAATGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173496
VALIDATED
MPP7 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-2111s21c1
Sequence:GTACCGGGCCAGTGAGCTGGTTACATTCCTCGAGGAATGTAACCAGCTCACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173496.3-1869s21c1
Sequence:CCGGCCATCAATAGAGCGTTTGAGACTCGAGTCTCAAACGCTCTATTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-845s21c1
Sequence:CCGGACCACTGGGAGCTACCATTAACTCGAGTTAATGGTAGCTCCCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-2509s21c1
Sequence:CCGGTAGCTGTTGAAGGTATCAATTCTCGAGAATTGATACCTTCAACAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-1732s21c1
Sequence:CCGGACTACTACGGCACAAGTATAGCTCGAGCTATACTTGTGCCGTAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-1544s21c1
Sequence:CCGGGCTGAATGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-610s1c1
Sequence:CCGGCAAGCCATTAAACAGTGAGATCTCGAGATCTCACTGTTTAATGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-1820s1c1
Sequence:CCGGCCATCAATAGAGCGTTTGAGACTCGAGTCTCAAACGCTCTATTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-493s1c1
Sequence:CCGGCCTGCATTCATTGGTAAAGATCTCGAGATCTTTACCAATGAATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-1495s1c1
Sequence:CCGGGCTGAATGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173496.2-947s1c1
Sequence:CCGGCCTGAGGAAATAATACAGATTCTCGAGAATCTGTATTATTTCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173496.2-492s1c1
Sequence:CCGGGCCTGCATTCATTGGTAAAGACTCGAGTCTTTACCAATGAATGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173496
VALIDATED
MPP7 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-2111s21c1
Sequence:GTACCGGGCCAGTGAGCTGGTTACATTCCTCGAGGAATGTAACCAGCTCACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173496.3-1869s21c1
Sequence:CCGGCCATCAATAGAGCGTTTGAGACTCGAGTCTCAAACGCTCTATTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-845s21c1
Sequence:CCGGACCACTGGGAGCTACCATTAACTCGAGTTAATGGTAGCTCCCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-2509s21c1
Sequence:CCGGTAGCTGTTGAAGGTATCAATTCTCGAGAATTGATACCTTCAACAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-1732s21c1
Sequence:CCGGACTACTACGGCACAAGTATAGCTCGAGCTATACTTGTGCCGTAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_173496.3-1544s21c1
Sequence:CCGGGCTGAATGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-610s1c1
Sequence:CCGGCAAGCCATTAAACAGTGAGATCTCGAGATCTCACTGTTTAATGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-1820s1c1
Sequence:CCGGCCATCAATAGAGCGTTTGAGACTCGAGTCTCAAACGCTCTATTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-493s1c1
Sequence:CCGGCCTGCATTCATTGGTAAAGATCTCGAGATCTTTACCAATGAATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173496.2-1495s1c1
Sequence:CCGGGCTGAATGAACTGAAACGAAACTCGAGTTTCGTTTCAGTTCATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173496.2-947s1c1
Sequence:CCGGCCTGAGGAAATAATACAGATTCTCGAGAATCTGTATTATTTCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173496.2-492s1c1
Sequence:CCGGGCCTGCATTCATTGGTAAAGACTCGAGTCTTTACCAATGAATGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081287
VALIDATED
MPP7 MISSION shRNA Bacterial Glycerol Stock
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-1569s21c1
Sequence:CCGGACTATTATGGTACAAGTATAGCTCGAGCTATACTTGTACCATAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-1973s21c1
Sequence:CCGGCTCAGAGAAATGTCCTTAATTCTCGAGAATTAAGGACATTTCTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081287.1-1542s21c1
Sequence:CCGGTCATTGAGTATGGTGAATATACTCGAGTATATTCACCATACTCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-917s21c1
Sequence:CCGGTCGAAAGAAGGCAAGATATTTCTCGAGAAATATCTTGCCTTCTTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-971s21c1
Sequence:CCGGGACAAGGCAATCCCGTGTAAACTCGAGTTTACACGGGATTGCCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081287
VALIDATED
MPP7 MISSION shRNA shRNA Plasmid DNA
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-1569s21c1
Sequence:CCGGACTATTATGGTACAAGTATAGCTCGAGCTATACTTGTACCATAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-1973s21c1
Sequence:CCGGCTCAGAGAAATGTCCTTAATTCTCGAGAATTAAGGACATTTCTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081287.1-1542s21c1
Sequence:CCGGTCATTGAGTATGGTGAATATACTCGAGTATATTCACCATACTCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-917s21c1
Sequence:CCGGTCGAAAGAAGGCAAGATATTTCTCGAGAAATATCTTGCCTTCTTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-971s21c1
Sequence:CCGGGACAAGGCAATCCCGTGTAAACTCGAGTTTACACGGGATTGCCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081287
VALIDATED
MPP7 MISSION shRNA Lentiviral Transduction Particles
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-1569s21c1
Sequence:CCGGACTATTATGGTACAAGTATAGCTCGAGCTATACTTGTACCATAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-1973s21c1
Sequence:CCGGCTCAGAGAAATGTCCTTAATTCTCGAGAATTAAGGACATTTCTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081287.1-1542s21c1
Sequence:CCGGTCATTGAGTATGGTGAATATACTCGAGTATATTCACCATACTCAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-917s21c1
Sequence:CCGGTCGAAAGAAGGCAAGATATTTCTCGAGAAATATCTTGCCTTCTTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081287.1-971s21c1
Sequence:CCGGGACAAGGCAATCCCGTGTAAACTCGAGTTTACACGGGATTGCCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)