EMAIL THIS PAGE TO A FRIEND

MPPE1

metallophosphoesterase 1

53 Gene Product Result for
Synonyms: PGAP5
Gene ID:
Mouse(225651) metallophosphoesterase 1
Rat(361344) metallophosphoesterase 1
Zebrafish(550396) metallophosphoesterase 1
chicken(421031) metallophosphoesterase 1
dog(490556) metallophosphoesterase 1
domestic cat(101098831) metallophosphoesterase 1
cow(506830) metallophosphoesterase 1
Horse(100058827) metallophosphoesterase 1
domestic guinea pig(100734325) metallophosphoesterase 1
naked mole-rat(101715603) metallophosphoesterase 1
sheep(101105710) metallophosphoesterase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023075 Rosetta Predictions human pricing
NM_001108435 Rosetta Predictions rat pricing
NM_172630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081499 predicted 1452
2 SASI_Hs01_00081500 predicted 1277
3 SASI_Hs01_00081501 predicted 1077
4 SASI_Hs01_00081503 predicted 1035
5 SASI_Hs02_00356315 predicted 722
6 SASI_Hs01_00081504 predicted 1107
7 SASI_Hs01_00081505 predicted 1087
8 SASI_Hs01_00081506 predicted 1789
9 SASI_Hs01_00081507 predicted 1188
10 SASI_Hs01_00081508 predicted 754
11 SASI_Hs01_00081502 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238609 predicted 1274
2 SASI_Rn02_00238610 predicted 1263
3 SASI_Rn02_00238611 predicted 721
4 SASI_Rn02_00238612 predicted 511
5 SASI_Rn02_00238613 predicted 1471
6 SASI_Rn02_00238614 predicted 976
7 SASI_Rn02_00238615 predicted 1334
8 SASI_Rn02_00238616 predicted 934
9 SASI_Rn02_00238617 predicted 993
10 SASI_Rn02_00238618 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153930 predicted 665
2 SASI_Mm01_00153931 predicted 921
3 SASI_Mm01_00153932 predicted 1469
4 SASI_Mm01_00153933 predicted 749
5 SASI_Mm01_00153934 predicted 1188
6 SASI_Mm02_00344336 predicted 1170
7 SASI_Mm02_00344337 predicted 1234
8 SASI_Mm01_00153935 predicted 1625
9 SASI_Mm01_00153936 predicted 714
10 SASI_Mm01_00153937 predicted 1623
11 SASI_Mm01_00153938 predicted 1099
12 SASI_Mm01_00153939 predicted 1381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023075
MPPE1 MISSION shRNA Bacterial Glycerol Stock
metallophosphoesterase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023075.2-2182s1c1
Sequence:CCGGGTACTCTACAACAAATCTGTTCTCGAGAACAGATTTGTTGTAGAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1284s1c1
Sequence:CCGGCCATTATGAGATGAACACATACTCGAGTATGTGTTCATCTCATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1614s1c1
Sequence:CCGGCATCCCATTTAAGGAGAACTACTCGAGTAGTTCTCCTTAAATGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-865s1c1
Sequence:CCGGCTGTTGAAACTCATAGCTGTTCTCGAGAACAGCTATGAGTTTCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1000s1c1
Sequence:CCGGCCTGTGCTCAAAGCCATGTTTCTCGAGAAACATGGCTTTGAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023075
MPPE1 MISSION shRNA shRNA Plasmid DNA
metallophosphoesterase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023075.2-2182s1c1
Sequence:CCGGGTACTCTACAACAAATCTGTTCTCGAGAACAGATTTGTTGTAGAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1284s1c1
Sequence:CCGGCCATTATGAGATGAACACATACTCGAGTATGTGTTCATCTCATAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1614s1c1
Sequence:CCGGCATCCCATTTAAGGAGAACTACTCGAGTAGTTCTCCTTAAATGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-865s1c1
Sequence:CCGGCTGTTGAAACTCATAGCTGTTCTCGAGAACAGCTATGAGTTTCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1000s1c1
Sequence:CCGGCCTGTGCTCAAAGCCATGTTTCTCGAGAAACATGGCTTTGAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023075
MPPE1 MISSION shRNA Lentiviral Transduction Particles
metallophosphoesterase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023075.2-2182s1c1
Sequence:CCGGGTACTCTACAACAAATCTGTTCTCGAGAACAGATTTGTTGTAGAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1284s1c1
Sequence:CCGGCCATTATGAGATGAACACATACTCGAGTATGTGTTCATCTCATAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1614s1c1
Sequence:CCGGCATCCCATTTAAGGAGAACTACTCGAGTAGTTCTCCTTAAATGGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-865s1c1
Sequence:CCGGCTGTTGAAACTCATAGCTGTTCTCGAGAACAGCTATGAGTTTCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023075.2-1000s1c1
Sequence:CCGGCCTGTGCTCAAAGCCATGTTTCTCGAGAAACATGGCTTTGAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172630
VALIDATED
MPPE1 MISSION shRNA Bacterial Glycerol Stock
metallophosphoesterase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1081s21c1
Sequence:CCGGTGCAGCTGAAGGTGGTCATTGCTCGAGCAATGACCACCTTCAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172630.2-891s21c1
Sequence:CCGGGGCCATTGGCTGGACAAATTACTCGAGTAATTTGTCCAGCCAATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.2-1121s1c1
Sequence:CCGGCCACTATCAGATGAGTAAATACTCGAGTATTTACTCATCTGATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.1-1608s1c1
Sequence:CCGGCCCATCTTTCAGTTGGAGGAACTCGAGTTCCTCCAACTGAAAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.2-716s1c1
Sequence:CCGGGAAACTCACAGTTGTCATTATCTCGAGATAATGACAACTGTGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1275s21c1
Sequence:CCGGCTCAGAGAGATCTCTCGTAAACTCGAGTTTACGAGAGATCTCTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1121s21c1
Sequence:CCGGCCACTATCAGATGAGTAAATACTCGAGTATTTACTCATCTGATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1185s21c1
Sequence:CCGGCTCTCTCTGAAAGGAGTTAATCTCGAGATTAACTCCTTTCAGAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172630
VALIDATED
MPPE1 MISSION shRNA shRNA Plasmid DNA
metallophosphoesterase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1081s21c1
Sequence:CCGGTGCAGCTGAAGGTGGTCATTGCTCGAGCAATGACCACCTTCAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172630.2-891s21c1
Sequence:CCGGGGCCATTGGCTGGACAAATTACTCGAGTAATTTGTCCAGCCAATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.2-1121s1c1
Sequence:CCGGCCACTATCAGATGAGTAAATACTCGAGTATTTACTCATCTGATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.1-1608s1c1
Sequence:CCGGCCCATCTTTCAGTTGGAGGAACTCGAGTTCCTCCAACTGAAAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.2-716s1c1
Sequence:CCGGGAAACTCACAGTTGTCATTATCTCGAGATAATGACAACTGTGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1275s21c1
Sequence:CCGGCTCAGAGAGATCTCTCGTAAACTCGAGTTTACGAGAGATCTCTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1121s21c1
Sequence:CCGGCCACTATCAGATGAGTAAATACTCGAGTATTTACTCATCTGATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1185s21c1
Sequence:CCGGCTCTCTCTGAAAGGAGTTAATCTCGAGATTAACTCCTTTCAGAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172630
VALIDATED
MPPE1 MISSION shRNA Lentiviral Transduction Particles
metallophosphoesterase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1081s21c1
Sequence:CCGGTGCAGCTGAAGGTGGTCATTGCTCGAGCAATGACCACCTTCAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172630.2-891s21c1
Sequence:CCGGGGCCATTGGCTGGACAAATTACTCGAGTAATTTGTCCAGCCAATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.2-1121s1c1
Sequence:CCGGCCACTATCAGATGAGTAAATACTCGAGTATTTACTCATCTGATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.1-1608s1c1
Sequence:CCGGCCCATCTTTCAGTTGGAGGAACTCGAGTTCCTCCAACTGAAAGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172630.2-716s1c1
Sequence:CCGGGAAACTCACAGTTGTCATTATCTCGAGATAATGACAACTGTGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1275s21c1
Sequence:CCGGCTCAGAGAGATCTCTCGTAAACTCGAGTTTACGAGAGATCTCTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1121s21c1
Sequence:CCGGCCACTATCAGATGAGTAAATACTCGAGTATTTACTCATCTGATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172630.2-1185s21c1
Sequence:CCGGCTCTCTCTGAAAGGAGTTAATCTCGAGATTAACTCCTTTCAGAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)