EMAIL THIS PAGE TO A FRIEND

MPPED1

metallophosphoesterase domain containing 1

59 Gene Product Result for
Synonyms: 239AB C22orf1 FAM1A
UniProtKB ID: O15442, A8K159, Q8N361
Gene ID:
Mouse(223726) metallophosphoesterase domain containing 1
Rat(362971) metallophosphoesterase domain containing 1
chicken(418229) metallophosphoesterase domain containing 1
domestic cat(101087330) metallophosphoesterase domain containing 1
cow(526018) metallophosphoesterase domain containing 1
dog(609458) metallophosphoesterase domain containing 1
sheep(101116897) metallophosphoesterase domain containing 1
naked mole-rat(101711020) metallophosphoesterase domain containing 1
domestic guinea pig(100722993) metallophosphoesterase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001585 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU197631 MISSION® esiRNA esiRNA targeting mouse Mpped1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001044370 Rosetta Predictions human pricing
NM_001585 Rosetta Predictions human pricing
NM_001130569 Rosetta Predictions rat pricing
NM_172610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311322 predicted 1436
2 SASI_Hs02_00311323 predicted 665
3 SASI_Hs02_00311324 predicted 1046
4 SASI_Hs02_00311325 predicted 1151
5 SASI_Hs02_00311326 predicted 1473
6 SASI_Hs02_00311327 predicted 1454
7 SASI_Hs02_00311328 predicted 428
8 SASI_Hs02_00311329 predicted 1421
9 SASI_Hs02_00311330 predicted 1111
10 SASI_Hs02_00311331 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240836 predicted 533
2 SASI_Hs01_00240837 predicted 925
3 SASI_Hs01_00240838 predicted 1018
4 SASI_Hs01_00240839 predicted 1348
5 SASI_Hs01_00240840 predicted 1347
6 SASI_Hs01_00240841 predicted 1327
7 SASI_Hs01_00240842 predicted 295
8 SASI_Hs01_00240843 predicted 1297
9 SASI_Hs01_00240844 predicted 982
10 SASI_Hs01_00240845 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255859 predicted 1286
2 SASI_Rn02_00255860 predicted 207
3 SASI_Rn02_00255861 predicted 1542
4 SASI_Rn02_00255862 predicted 651
5 SASI_Rn02_00255863 predicted 1371
6 SASI_Rn02_00255864 predicted 1131
7 SASI_Rn02_00255865 predicted 1330
8 SASI_Rn02_00255866 predicted 230
9 SASI_Rn02_00255867 predicted 809
10 SASI_Rn02_00255868 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201721 predicted 1273
2 SASI_Mm02_00344307 predicted 290
3 SASI_Mm01_00201717 predicted 1450
4 SASI_Mm01_00201718 predicted 1615
5 SASI_Mm01_00201719 predicted 738
6 SASI_Mm01_00201720 predicted 454
7 SASI_Mm01_00201722 predicted 1271
8 SASI_Mm01_00201723 predicted 1621
9 SASI_Mm01_00201724 predicted 545
10 SASI_Mm01_00201725 predicted 1563
11 SASI_Mm01_00201726 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172610
MPPED1 MISSION shRNA Bacterial Glycerol Stock
metallophosphoesterase domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172610.3-583s1c1
Sequence:CCGGCTATGAGTACAAGATCGTGATCTCGAGATCACGATCTTGTACTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172610.1-1505s1c1
Sequence:CCGGCGGATGGAATTTGGGAAGTTTCTCGAGAAACTTCCCAAATTCCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-648s1c1
Sequence:CCGGGACCTCATCAAGCAGGACTTTCTCGAGAAAGTCCTGCTTGATGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-876s1c1
Sequence:CCGGGAAGGAGTAGACATCCTTATACTCGAGTATAAGGATGTCTACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-466s1c1
Sequence:CCGGCAAGGACAGATCCCATTCAAACTCGAGTTTGAATGGGATCTGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172610.1-2075s1c1
Sequence:CCGGGCTTGTCAGTACCACCAGTAACTCGAGTTACTGGTGGTACTGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172610
MPPED1 MISSION shRNA shRNA Plasmid DNA
metallophosphoesterase domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172610.3-583s1c1
Sequence:CCGGCTATGAGTACAAGATCGTGATCTCGAGATCACGATCTTGTACTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172610.1-1505s1c1
Sequence:CCGGCGGATGGAATTTGGGAAGTTTCTCGAGAAACTTCCCAAATTCCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-648s1c1
Sequence:CCGGGACCTCATCAAGCAGGACTTTCTCGAGAAAGTCCTGCTTGATGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-876s1c1
Sequence:CCGGGAAGGAGTAGACATCCTTATACTCGAGTATAAGGATGTCTACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-466s1c1
Sequence:CCGGCAAGGACAGATCCCATTCAAACTCGAGTTTGAATGGGATCTGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172610.1-2075s1c1
Sequence:CCGGGCTTGTCAGTACCACCAGTAACTCGAGTTACTGGTGGTACTGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172610
MPPED1 MISSION shRNA Lentiviral Transduction Particles
metallophosphoesterase domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172610.3-583s1c1
Sequence:CCGGCTATGAGTACAAGATCGTGATCTCGAGATCACGATCTTGTACTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172610.1-1505s1c1
Sequence:CCGGCGGATGGAATTTGGGAAGTTTCTCGAGAAACTTCCCAAATTCCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-648s1c1
Sequence:CCGGGACCTCATCAAGCAGGACTTTCTCGAGAAAGTCCTGCTTGATGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-876s1c1
Sequence:CCGGGAAGGAGTAGACATCCTTATACTCGAGTATAAGGATGTCTACTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172610.1-466s1c1
Sequence:CCGGCAAGGACAGATCCCATTCAAACTCGAGTTTGAATGGGATCTGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172610.1-2075s1c1
Sequence:CCGGGCTTGTCAGTACCACCAGTAACTCGAGTTACTGGTGGTACTGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001585
MPPED1 MISSION shRNA Bacterial Glycerol Stock
metallophosphoesterase domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-980s1c1
Sequence:CCGGCCTATGTGAATGCGTCCGTATCTCGAGATACGGACGCATTCACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-504s1c1
Sequence:CCGGCTACGAGTACAAGATCGTGATCTCGAGATCACGATCTTGTACTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-568s1c1
Sequence:CCGGGACCTCATCAAGCAGGACTTTCTCGAGAAAGTCCTGCTTGATGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-796s1c1
Sequence:CCGGGAAGGCGTAGACATCCTGATACTCGAGTATCAGGATGTCTACGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-252s1c1
Sequence:CCGGCCAGGCCTTCACCTTCTACAACTCGAGTTGTAGAAGGTGAAGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001585
MPPED1 MISSION shRNA shRNA Plasmid DNA
metallophosphoesterase domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-980s1c1
Sequence:CCGGCCTATGTGAATGCGTCCGTATCTCGAGATACGGACGCATTCACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-504s1c1
Sequence:CCGGCTACGAGTACAAGATCGTGATCTCGAGATCACGATCTTGTACTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-568s1c1
Sequence:CCGGGACCTCATCAAGCAGGACTTTCTCGAGAAAGTCCTGCTTGATGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-796s1c1
Sequence:CCGGGAAGGCGTAGACATCCTGATACTCGAGTATCAGGATGTCTACGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-252s1c1
Sequence:CCGGCCAGGCCTTCACCTTCTACAACTCGAGTTGTAGAAGGTGAAGGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001585
MPPED1 MISSION shRNA Lentiviral Transduction Particles
metallophosphoesterase domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-980s1c1
Sequence:CCGGCCTATGTGAATGCGTCCGTATCTCGAGATACGGACGCATTCACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-504s1c1
Sequence:CCGGCTACGAGTACAAGATCGTGATCTCGAGATCACGATCTTGTACTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-568s1c1
Sequence:CCGGGACCTCATCAAGCAGGACTTTCTCGAGAAAGTCCTGCTTGATGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-796s1c1
Sequence:CCGGGAAGGCGTAGACATCCTGATACTCGAGTATCAGGATGTCTACGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001585.2-252s1c1
Sequence:CCGGCCAGGCCTTCACCTTCTACAACTCGAGTTGTAGAAGGTGAAGGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)