EMAIL THIS PAGE TO A FRIEND

MPPED2

metallophosphoesterase domain containing 2

173 Gene Product Result for
Synonyms: 239FB C11orf8
UniProtKB ID: Q15777, D3DQZ5, E9PB10, Q59GE6
Gene ID:
Human(744) Summary: This gene likely encodes a metallophosphoesterase. The encoded protein may play a role a brain development. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Mouse(77015) metallophosphoesterase domain containing 2
Rat(362185) metallophosphoesterase domain containing 2
domestic guinea pig(100726535) metallophosphoesterase domain containing 2
naked mole-rat(101708784) metallophosphoesterase domain containing 2
sheep(101118984) metallophosphoesterase domain containing 2
Zebrafish(336959) metallophosphoesterase domain containing 2b
cow(540914) metallophosphoesterase domain containing 2
domestic cat(101085494) metallophosphoesterase domain containing 2
dog(607678) metallophosphoesterase domain containing 2
chicken(421604) metallophosphoesterase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001584 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001584 Rosetta Predictions human pricing
NM_198778 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041317 predicted 617
2 SASI_Hs01_00041318 predicted 883
3 SASI_Hs01_00041319 predicted 476
4 SASI_Hs02_00332150 predicted 408
5 SASI_Hs01_00041320 predicted 584
6 SASI_Hs01_00041321 predicted 746
7 SASI_Hs01_00041322 predicted 468
8 SASI_Hs01_00041323 predicted 424
9 SASI_Hs01_00041324 predicted 609
10 SASI_Hs01_00041325 predicted 906
11 SASI_Hs01_00041326 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270034 predicted 827
2 SASI_Rn02_00270035 predicted 932
3 SASI_Rn01_00090377 predicted 364
4 SASI_Rn02_00270036 predicted 254
5 SASI_Rn02_00270037 predicted 936
6 SASI_Rn02_00270038 predicted 506
7 SASI_Rn02_00270039 predicted 438
8 SASI_Rn01_00090379 predicted 232
9 SASI_Rn02_00270040 predicted 504
10 SASI_Rn01_00090378 predicted 501
11 SASI_Rn01_00090374 predicted 340
12 SASI_Rn01_00090375 predicted 245
13 SASI_Rn01_00090376 predicted 789
14 SASI_Rn01_00090380 predicted 665
15 SASI_Rn01_00090381 predicted 373
16 SASI_Rn01_00090382 predicted 407
17 SASI_Rn01_00090383 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001584
MPPED2 MISSION shRNA Bacterial Glycerol Stock
metallophosphoesterase domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-903s1c1
Sequence:CCGGCGACGGTTACACAACGTACATCTCGAGATGTACGTTGTGTAACCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-582s1c1
Sequence:CCGGCCTCCTGACAAACAGTATTTACTCGAGTAAATACTGTTTGTCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-507s1c1
Sequence:CCGGCCTTGTTAAACAGGACTACTACTCGAGTAGTAGTCCTGTTTAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-879s1c1
Sequence:CCGGCCATGAAGGTTATGGCATCATCTCGAGATGATGCCATAACCTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-398s1c1
Sequence:CCGGCCTCAGAGGTTAAGAAGTTTACTCGAGTAAACTTCTTAACCTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001584
MPPED2 MISSION shRNA shRNA Plasmid DNA
metallophosphoesterase domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-903s1c1
Sequence:CCGGCGACGGTTACACAACGTACATCTCGAGATGTACGTTGTGTAACCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-582s1c1
Sequence:CCGGCCTCCTGACAAACAGTATTTACTCGAGTAAATACTGTTTGTCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-507s1c1
Sequence:CCGGCCTTGTTAAACAGGACTACTACTCGAGTAGTAGTCCTGTTTAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-879s1c1
Sequence:CCGGCCATGAAGGTTATGGCATCATCTCGAGATGATGCCATAACCTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-398s1c1
Sequence:CCGGCCTCAGAGGTTAAGAAGTTTACTCGAGTAAACTTCTTAACCTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001584
MPPED2 MISSION shRNA Lentiviral Transduction Particles
metallophosphoesterase domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-903s1c1
Sequence:CCGGCGACGGTTACACAACGTACATCTCGAGATGTACGTTGTGTAACCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-582s1c1
Sequence:CCGGCCTCCTGACAAACAGTATTTACTCGAGTAAATACTGTTTGTCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-507s1c1
Sequence:CCGGCCTTGTTAAACAGGACTACTACTCGAGTAGTAGTCCTGTTTAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-879s1c1
Sequence:CCGGCCATGAAGGTTATGGCATCATCTCGAGATGATGCCATAACCTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001584.1-398s1c1
Sequence:CCGGCCTCAGAGGTTAAGAAGTTTACTCGAGTAAACTTCTTAACCTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)