EMAIL THIS PAGE TO A FRIEND

MPRIP

myosin phosphatase Rho interacting protein

102 Gene Product Result for
Synonyms: M-RIP MRIP RHOIP3 RIP3 p116Rip
Gene ID:
Mouse(26936) myosin phosphatase Rho interacting protein
Rat(116504) myosin phosphatase Rho interacting protein
sheep(101113946) myosin phosphatase Rho interacting protein
naked mole-rat(101710797) myosin phosphatase Rho interacting protein
domestic guinea pig(100729338) myosin phosphatase Rho interacting protein
chicken(416502) myosin phosphatase Rho interacting protein
domestic cat(101089054) myosin phosphatase Rho interacting protein
cow(533979) myosin phosphatase Rho interacting protein
Horse(100052994) myosin phosphatase Rho interacting protein
dog(479530) myosin phosphatase Rho interacting protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015134 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015134 Rosetta Predictions human pricing
NM_201274 Rosetta Predictions human pricing
NM_001034022 Rosetta Predictions rat pricing
NM_053814 Rosetta Predictions rat pricing
NM_012027 Rosetta Predictions mouse pricing
NM_201245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079609 predicted 1430
2 SASI_Hs01_00079610 predicted 1356
3 SASI_Hs01_00079611 predicted 2865
4 SASI_Hs01_00079612 predicted 2300
5 SASI_Hs01_00079613 predicted 1272
6 SASI_Hs01_00079614 predicted 1292
7 SASI_Hs01_00079615 predicted 1368
8 SASI_Hs01_00079616 predicted 268
9 SASI_Hs01_00079617 predicted 1270
10 SASI_Hs01_00079618 predicted 2747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165091 predicted 1430
2 SASI_Hs01_00165092 predicted 1357
3 SASI_Hs01_00165093 predicted 2860
4 SASI_Hs01_00165094 predicted 2305
5 SASI_Hs01_00165095 predicted 1268
6 SASI_Hs01_00165096 predicted 1292
7 SASI_Hs01_00165097 predicted 1359
8 SASI_Hs01_00165098 predicted 270
9 SASI_Hs01_00165099 predicted 1271
10 SASI_Hs01_00165100 predicted 2743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038579 predicted 2170
2 SASI_Rn01_00038581 predicted 2033
3 SASI_Rn02_00203907 predicted 1319
4 SASI_Rn01_00038582 predicted 2183
5 SASI_Rn01_00038583 predicted 3117
6 SASI_Rn01_00038584 predicted 265
7 SASI_Rn01_00038585 predicted 2590
8 SASI_Rn01_00038586 predicted 2375
9 SASI_Rn01_00038587 predicted 248
10 SASI_Rn01_00038588 predicted 2272
11 SASI_Rn01_00038580 predicted 2360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080389 predicted 2276
2 SASI_Rn01_00080391 predicted 2142
3 SASI_Rn02_00266640 predicted 1431
4 SASI_Rn01_00080392 predicted 2292
5 SASI_Rn01_00080393 predicted 3230
6 SASI_Rn01_00080394 predicted 268
7 SASI_Rn01_00080395 predicted 2689
8 SASI_Rn01_00080396 predicted 2484
9 SASI_Rn01_00080397 predicted 250
10 SASI_Rn01_00080398 predicted 2382
11 SASI_Rn01_00080390 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042335 predicted 2379
2 SASI_Mm01_00042336 predicted 2567
3 SASI_Mm01_00042337 predicted 2277
4 SASI_Mm01_00042339 predicted 388
5 SASI_Mm02_00321995 predicted 2392
6 SASI_Mm01_00042340 predicted 2799
7 SASI_Mm01_00042341 predicted 2582
8 SASI_Mm02_00321996 predicted 2486
9 SASI_Mm01_00042343 predicted 1494
10 SASI_Mm01_00042344 predicted 2575
11 SASI_Mm01_00042338 predicted 1407
12 SASI_Mm01_00042342 predicted 2994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192212 predicted 2489
2 SASI_Mm01_00192213 predicted 2669
3 SASI_Mm01_00192214 predicted 2382
4 SASI_Mm01_00192216 predicted 490
5 SASI_Mm02_00351497 predicted 2490
6 SASI_Mm01_00192217 predicted 2895
7 SASI_Mm01_00192218 predicted 2685
8 SASI_Mm02_00351498 predicted 2591
9 SASI_Mm01_00192220 predicted 1598
10 SASI_Mm01_00192221 predicted 2672
11 SASI_Mm01_00192215 predicted 1508
12 SASI_Mm01_00192219 predicted 3097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015134
VALIDATED
MPRIP MISSION shRNA Bacterial Glycerol Stock
myosin phosphatase Rho interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015134.1-2748s1c1
Sequence:CCGGGCCTATGAACTAGAGGTCTTACTCGAGTAAGACCTCTAGTTCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-1332s1c1
Sequence:CCGGGCCGACTTGGATGGAGAAATTCTCGAGAATTTCTCCATCCAAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-266s1c1
Sequence:CCGGGCGACGGTTCTTCATCCTTTACTCGAGTAAAGGATGAAGAACCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-398s1c1
Sequence:CCGGCCAGAAGTTCTCCCTGTGTATCTCGAGATACACAGGGAGAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-3137s1c1
Sequence:CCGGGCTCTTTGAATCCAGGGACTTCTCGAGAAGTCCCTGGATTCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-2762s21c1
Sequence:CCGGAGAGGTCTTATTGCGGGTAAACTCGAGTTTACCCGCAATAAGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-1335s21c1
Sequence:CCGGGCCGACTTGGATGGAGAAATTCTCGAGAATTTCTCCATCCAAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-398s21c1
Sequence:CCGGCCAGAAGTTCTCCCTGTGTATCTCGAGATACACAGGGAGAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-2863s21c1
Sequence:CCGGACGCAAGTGACAAGTACAAAGCTCGAGCTTTGTACTTGTCACTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015134.2-3140s21c1
Sequence:CCGGGCTCTTTGAATCCAGGGACTTCTCGAGAAGTCCCTGGATTCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015134
VALIDATED
MPRIP MISSION shRNA shRNA Plasmid DNA
myosin phosphatase Rho interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015134.1-2748s1c1
Sequence:CCGGGCCTATGAACTAGAGGTCTTACTCGAGTAAGACCTCTAGTTCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-1332s1c1
Sequence:CCGGGCCGACTTGGATGGAGAAATTCTCGAGAATTTCTCCATCCAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-266s1c1
Sequence:CCGGGCGACGGTTCTTCATCCTTTACTCGAGTAAAGGATGAAGAACCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-398s1c1
Sequence:CCGGCCAGAAGTTCTCCCTGTGTATCTCGAGATACACAGGGAGAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-3137s1c1
Sequence:CCGGGCTCTTTGAATCCAGGGACTTCTCGAGAAGTCCCTGGATTCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-2762s21c1
Sequence:CCGGAGAGGTCTTATTGCGGGTAAACTCGAGTTTACCCGCAATAAGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-1335s21c1
Sequence:CCGGGCCGACTTGGATGGAGAAATTCTCGAGAATTTCTCCATCCAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-398s21c1
Sequence:CCGGCCAGAAGTTCTCCCTGTGTATCTCGAGATACACAGGGAGAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-2863s21c1
Sequence:CCGGACGCAAGTGACAAGTACAAAGCTCGAGCTTTGTACTTGTCACTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015134.2-3140s21c1
Sequence:CCGGGCTCTTTGAATCCAGGGACTTCTCGAGAAGTCCCTGGATTCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015134
VALIDATED
MPRIP MISSION shRNA Lentiviral Transduction Particles
myosin phosphatase Rho interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015134.1-2748s1c1
Sequence:CCGGGCCTATGAACTAGAGGTCTTACTCGAGTAAGACCTCTAGTTCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-1332s1c1
Sequence:CCGGGCCGACTTGGATGGAGAAATTCTCGAGAATTTCTCCATCCAAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-266s1c1
Sequence:CCGGGCGACGGTTCTTCATCCTTTACTCGAGTAAAGGATGAAGAACCGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-398s1c1
Sequence:CCGGCCAGAAGTTCTCCCTGTGTATCTCGAGATACACAGGGAGAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015134.1-3137s1c1
Sequence:CCGGGCTCTTTGAATCCAGGGACTTCTCGAGAAGTCCCTGGATTCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-2762s21c1
Sequence:CCGGAGAGGTCTTATTGCGGGTAAACTCGAGTTTACCCGCAATAAGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-1335s21c1
Sequence:CCGGGCCGACTTGGATGGAGAAATTCTCGAGAATTTCTCCATCCAAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-398s21c1
Sequence:CCGGCCAGAAGTTCTCCCTGTGTATCTCGAGATACACAGGGAGAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015134.2-2863s21c1
Sequence:CCGGACGCAAGTGACAAGTACAAAGCTCGAGCTTTGTACTTGTCACTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015134.2-3140s21c1
Sequence:CCGGGCTCTTTGAATCCAGGGACTTCTCGAGAAGTCCCTGGATTCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201245
VALIDATED
MPRIP MISSION shRNA Bacterial Glycerol Stock
myosin phosphatase Rho interacting protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-3691s1c1
Sequence:CCGGGCACACTCACTGTCAGTATTACTCGAGTAATACTGACAGTGAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-1570s1c1
Sequence:CCGGGCTGACCTAGATGGAGAAATTCTCGAGAATTTCTCCATCTAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201245.1-2590s1c1
Sequence:CCGGGCCACCATATCAGCCATTGAACTCGAGTTCAATGGCTGATATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-1532s1c1
Sequence:CCGGGCCTGAGATACTACAGGGATTCTCGAGAATCCCTGTAGTATCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-505s1c1
Sequence:CCGGCGACGATTCTTCATCCTTTATCTCGAGATAAAGGATGAAGAATCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-1569s21c1
Sequence:CCGGGCCTGAGATACTACAGGGATTCTCGAGAATCCCTGTAGTATCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201245.3-3728s21c1
Sequence:CCGGGCACACTCACTGTCAGTATTACTCGAGTAATACTGACAGTGAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-1607s21c1
Sequence:CCGGGCTGACCTAGATGGAGAAATTCTCGAGAATTTCTCCATCTAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-542s21c1
Sequence:CCGGCGACGATTCTTCATCCTTTATCTCGAGATAAAGGATGAAGAATCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201245
VALIDATED
MPRIP MISSION shRNA shRNA Plasmid DNA
myosin phosphatase Rho interacting protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-3691s1c1
Sequence:CCGGGCACACTCACTGTCAGTATTACTCGAGTAATACTGACAGTGAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-1570s1c1
Sequence:CCGGGCTGACCTAGATGGAGAAATTCTCGAGAATTTCTCCATCTAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201245.1-2590s1c1
Sequence:CCGGGCCACCATATCAGCCATTGAACTCGAGTTCAATGGCTGATATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-1532s1c1
Sequence:CCGGGCCTGAGATACTACAGGGATTCTCGAGAATCCCTGTAGTATCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-505s1c1
Sequence:CCGGCGACGATTCTTCATCCTTTATCTCGAGATAAAGGATGAAGAATCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-1569s21c1
Sequence:CCGGGCCTGAGATACTACAGGGATTCTCGAGAATCCCTGTAGTATCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201245.3-3728s21c1
Sequence:CCGGGCACACTCACTGTCAGTATTACTCGAGTAATACTGACAGTGAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-1607s21c1
Sequence:CCGGGCTGACCTAGATGGAGAAATTCTCGAGAATTTCTCCATCTAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-542s21c1
Sequence:CCGGCGACGATTCTTCATCCTTTATCTCGAGATAAAGGATGAAGAATCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201245
VALIDATED
MPRIP MISSION shRNA Lentiviral Transduction Particles
myosin phosphatase Rho interacting protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-3691s1c1
Sequence:CCGGGCACACTCACTGTCAGTATTACTCGAGTAATACTGACAGTGAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-1570s1c1
Sequence:CCGGGCTGACCTAGATGGAGAAATTCTCGAGAATTTCTCCATCTAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201245.1-2590s1c1
Sequence:CCGGGCCACCATATCAGCCATTGAACTCGAGTTCAATGGCTGATATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-1532s1c1
Sequence:CCGGGCCTGAGATACTACAGGGATTCTCGAGAATCCCTGTAGTATCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_201245.1-505s1c1
Sequence:CCGGCGACGATTCTTCATCCTTTATCTCGAGATAAAGGATGAAGAATCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-1569s21c1
Sequence:CCGGGCCTGAGATACTACAGGGATTCTCGAGAATCCCTGTAGTATCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201245.3-3728s21c1
Sequence:CCGGGCACACTCACTGTCAGTATTACTCGAGTAATACTGACAGTGAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-1607s21c1
Sequence:CCGGGCTGACCTAGATGGAGAAATTCTCGAGAATTTCTCCATCTAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201245.3-542s21c1
Sequence:CCGGCGACGATTCTTCATCCTTTATCTCGAGATAAAGGATGAAGAATCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)