EMAIL THIS PAGE TO A FRIEND

MPST

mercaptopyruvate sulfurtransferase

111 Gene Product Result for
Synonyms: MST TST2
UniProtKB ID: P25325, O75750
Gene ID:
Human(4357) Summary: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(246221) mercaptopyruvate sulfurtransferase
Rat(192172) mercaptopyruvate sulfurtransferase
sheep(101102135) mercaptopyruvate sulfurtransferase
domestic guinea pig(100729817) mercaptopyruvate sulfurtransferase
naked mole-rat(101697451) mercaptopyruvate sulfurtransferase
chicken(418048) mercaptopyruvate sulfurtransferase
cow(783474) mercaptopyruvate sulfurtransferase-like
dog(474515) mercaptopyruvate sulfurtransferase
domestic cat(101091882) mercaptopyruvate sulfurtransferase
cow(507313) mercaptopyruvate sulfurtransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021126 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086511 MISSION® esiRNA esiRNA human MPST (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013436 Rosetta Predictions human pricing
NM_001013440 Rosetta Predictions human pricing
NM_021126 Rosetta Predictions human pricing
NM_138843 Rosetta Predictions rat pricing
XM_579654 Rosetta Predictions rat pricing
NM_138670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306373 predicted 819
2 SASI_Hs01_00141518 predicted 738
3 SASI_Hs01_00141519 predicted 663
4 SASI_Hs01_00141520 predicted 589
5 SASI_Hs01_00141521 predicted 807
6 SASI_Hs01_00141522 predicted 1077
7 SASI_Hs01_00141523 predicted 813
8 SASI_Hs01_00141525 predicted 744
9 SASI_Hs01_00141526 predicted 630
10 SASI_Hs01_00141527 predicted 419
11 SASI_Hs01_00141524 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306378 predicted 1102
2 SASI_Hs01_00184592 predicted 1013
3 SASI_Hs01_00184593 predicted 936
4 SASI_Hs01_00184594 predicted 867
5 SASI_Hs01_00184595 predicted 1086
6 SASI_Hs01_00184596 predicted 1351
7 SASI_Hs01_00184597 predicted 1091
8 SASI_Hs01_00184599 predicted 1016
9 SASI_Hs01_00184600 predicted 904
10 SASI_Hs01_00184601 predicted 694
11 SASI_Hs01_00184598 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354640 predicted 921
2 SASI_Hs01_00209163 predicted 842
3 SASI_Hs01_00209164 predicted 760
4 SASI_Hs01_00209165 predicted 686
5 SASI_Hs01_00209166 predicted 912
6 SASI_Hs01_00209167 predicted 1175
7 SASI_Hs01_00209168 predicted 907
8 SASI_Hs01_00209170 predicted 843
9 SASI_Hs01_00209171 predicted 729
10 SASI_Hs01_00209172 predicted 517
11 SASI_Hs01_00209169 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115346 predicted 678
2 SASI_Rn01_00115347 predicted 486
3 SASI_Rn01_00115348 predicted 456
4 SASI_Rn01_00115349 predicted 1005
5 SASI_Rn01_00115350 predicted 620
6 SASI_Rn01_00115351 predicted 341
7 SASI_Rn01_00115352 predicted 884
8 SASI_Rn01_00115353 predicted 430
9 SASI_Rn01_00115354 predicted 615
10 SASI_Rn01_00115355 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130859 predicted 684
2 SASI_Rn01_00130860 predicted 743
3 SASI_Rn01_00130861 predicted 830
4 SASI_Rn01_00130862 predicted 664
5 SASI_Rn01_00130863 predicted 684
6 SASI_Rn01_00130864 predicted 705
7 SASI_Rn01_00130865 predicted 863
8 SASI_Rn01_00130866 predicted 635
9 SASI_Rn01_00130867 predicted 650
10 SASI_Rn01_00130868 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099253 predicted 663
2 SASI_Mm02_00339739 predicted 1046
3 SASI_Mm01_00099254 predicted 475
4 SASI_Mm01_00099255 predicted 332
5 SASI_Mm01_00099256 predicted 861
6 SASI_Mm01_00099257 predicted 411
7 SASI_Mm01_00099258 predicted 825
8 SASI_Mm01_00099260 predicted 794
9 SASI_Mm01_00099261 predicted 313
10 SASI_Mm01_00099262 predicted 433
11 SASI_Mm01_00099259 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021126
VALIDATED
MPST MISSION shRNA Bacterial Glycerol Stock
mercaptopyruvate sulfurtransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021126.3-999s1c1
Sequence:CCGGGCCCGAGGATGTCATCTCAGACTCGAGTCTGAGATGACATCCTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-851s1c1
Sequence:CCGGAGAAGAAAGTGGACCTGTCTACTCGAGTAGACAGGTCCACTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-1114s1c1
Sequence:CCGGGCTTTCACCAAGAGAGTGTTTCTCGAGAAACACTCTCTTGGTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-514s1c1
Sequence:CCGGCACGCCGTGTCACTGCTTGATCTCGAGATCAAGCAGTGACACGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021126.3-627s1c1
Sequence:CCGGCGCCTTCATCAAGACCTACGACTCGAGTCGTAGGTCTTGATGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021126
VALIDATED
MPST MISSION shRNA shRNA Plasmid DNA
mercaptopyruvate sulfurtransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021126.3-999s1c1
Sequence:CCGGGCCCGAGGATGTCATCTCAGACTCGAGTCTGAGATGACATCCTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-851s1c1
Sequence:CCGGAGAAGAAAGTGGACCTGTCTACTCGAGTAGACAGGTCCACTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-1114s1c1
Sequence:CCGGGCTTTCACCAAGAGAGTGTTTCTCGAGAAACACTCTCTTGGTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-514s1c1
Sequence:CCGGCACGCCGTGTCACTGCTTGATCTCGAGATCAAGCAGTGACACGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021126.3-627s1c1
Sequence:CCGGCGCCTTCATCAAGACCTACGACTCGAGTCGTAGGTCTTGATGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021126
VALIDATED
MPST MISSION shRNA Lentiviral Transduction Particles
mercaptopyruvate sulfurtransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021126.3-999s1c1
Sequence:CCGGGCCCGAGGATGTCATCTCAGACTCGAGTCTGAGATGACATCCTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-851s1c1
Sequence:CCGGAGAAGAAAGTGGACCTGTCTACTCGAGTAGACAGGTCCACTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-1114s1c1
Sequence:CCGGGCTTTCACCAAGAGAGTGTTTCTCGAGAAACACTCTCTTGGTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021126.3-514s1c1
Sequence:CCGGCACGCCGTGTCACTGCTTGATCTCGAGATCAAGCAGTGACACGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021126.3-627s1c1
Sequence:CCGGCGCCTTCATCAAGACCTACGACTCGAGTCGTAGGTCTTGATGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138670
VALIDATED
MPST MISSION shRNA Bacterial Glycerol Stock
mercaptopyruvate sulfurtransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-1183s1c1
Sequence:CCGGCAGACAACTGAGGGAGTGTTTCTCGAGAAACACTCCCTCAGTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-363s1c1
Sequence:CCGGGCCGCCTTCTTCGACATCGATCTCGAGATCGATGTCGAAGAAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-1046s1c1
Sequence:CCGGGCCAGAGCATATCATCTCTGACTCGAGTCAGAGATGATATGCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-599s1c1
Sequence:CCGGGCTGAATCAGAACCTGCCAATCTCGAGATTGGCAGGTTCTGATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-873s1c1
Sequence:CCGGGAGGAGATCAAACGCCTGTTTCTCGAGAAACAGGCGTTTGATCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138670
VALIDATED
MPST MISSION shRNA shRNA Plasmid DNA
mercaptopyruvate sulfurtransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-1183s1c1
Sequence:CCGGCAGACAACTGAGGGAGTGTTTCTCGAGAAACACTCCCTCAGTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-363s1c1
Sequence:CCGGGCCGCCTTCTTCGACATCGATCTCGAGATCGATGTCGAAGAAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-1046s1c1
Sequence:CCGGGCCAGAGCATATCATCTCTGACTCGAGTCAGAGATGATATGCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-599s1c1
Sequence:CCGGGCTGAATCAGAACCTGCCAATCTCGAGATTGGCAGGTTCTGATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-873s1c1
Sequence:CCGGGAGGAGATCAAACGCCTGTTTCTCGAGAAACAGGCGTTTGATCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138670
VALIDATED
MPST MISSION shRNA Lentiviral Transduction Particles
mercaptopyruvate sulfurtransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-1183s1c1
Sequence:CCGGCAGACAACTGAGGGAGTGTTTCTCGAGAAACACTCCCTCAGTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-363s1c1
Sequence:CCGGGCCGCCTTCTTCGACATCGATCTCGAGATCGATGTCGAAGAAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-1046s1c1
Sequence:CCGGGCCAGAGCATATCATCTCTGACTCGAGTCAGAGATGATATGCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-599s1c1
Sequence:CCGGGCTGAATCAGAACCTGCCAATCTCGAGATTGGCAGGTTCTGATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138670.2-873s1c1
Sequence:CCGGGAGGAGATCAAACGCCTGTTTCTCGAGAAACAGGCGTTTGATCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)