EMAIL THIS PAGE TO A FRIEND

MPV17

MpV17 mitochondrial inner membrane protein

32 Gene Product Result for
Synonyms: MTDPS6 SYM1
UniProtKB ID: P39210, D6W555, Q53SY2, Q96B08
Gene ID:
Human(4358) Summary: This gene encodes a mitochondrial inner membrane protein that is implicated in the metabolism of reactive oxygen species. Mutations in this gene have been associated with the hepatocerebral form of mitochondrial DNA depletion syndrome (MDDS). [provided by RefSeq, Jul 2008]
Mouse(17527) MpV17 mitochondrial inner membrane protein
Zebrafish(394140) MpV17 transgene, murine homolog, glomerulosclerosis
chicken(100857465) MpV17 mitochondrial inner membrane protein
cow(505763) MpV17 mitochondrial inner membrane protein
domestic cat(101099629) MpV17 mitochondrial inner membrane protein
dog(611056) MpV17 mitochondrial inner membrane protein
sheep(101116554) MpV17 mitochondrial inner membrane protein
domestic guinea pig(100727969) MpV17 mitochondrial inner membrane protein
naked mole-rat(101712670) MpV17 mitochondrial inner membrane protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303122 ANTI-MPV17 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2501439 Anti-MPV17 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, bovine, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1406143 Anti-MPV17 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002437 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040151 MISSION® esiRNA esiRNA human MPV17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002437 Rosetta Predictions human pricing
NM_008622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055432 predicted 436
2 SASI_Hs01_00055433 predicted 463
3 SASI_Hs01_00055434 predicted 415
4 SASI_Hs01_00055435 predicted 290
5 SASI_Hs01_00055436 predicted 400
6 SASI_Hs01_00055437 predicted 409
7 SASI_Hs01_00055438 predicted 429
8 SASI_Hs02_00333837 predicted 199
9 SASI_Hs01_00055439 predicted 446
10 SASI_Hs01_00055440 predicted 388
11 SASI_Hs01_00055441 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314303 predicted 976
2 SASI_Mm02_00314304 predicted 859
3 SASI_Mm02_00314305 predicted 701
4 SASI_Mm02_00314306 predicted 755
5 SASI_Mm02_00314307 predicted 725
6 SASI_Mm02_00314308 predicted 539
7 SASI_Mm02_00314309 predicted 690
8 SASI_Mm02_00314310 predicted 601
9 SASI_Mm02_00314311 predicted 449
10 SASI_Mm02_00314312 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008622
VALIDATED
MPV17 MISSION shRNA Bacterial Glycerol Stock
MpV17 mitochondrial inner membrane protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-837s1c1
Sequence:CCGGCCCACGAATAGACACGCATTTCTCGAGAAATGCGTGTCTATTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-368s1c1
Sequence:CCGGTGGTCGGGATACTCAATGGAACTCGAGTTCCATTGAGTATCCCGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-115s1c1
Sequence:CCGGGCTGGATCACTGATGGGCGTACTCGAGTACGCCCATCAGTGATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-377s21c1
Sequence:CCGGTGGTCGGGATACTCAATGGAACTCGAGTTCCATTGAGTATCCCGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-446s21c1
Sequence:CCGGCCCTCATCACCAACTACTATCCTCGAGGATAGTAGTTGGTGATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-526s21c1
Sequence:CCGGGTTGTCCAGTGTGTTGCTATTCTCGAGAATAGCAACACACTGGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008622.5-846s21c1
Sequence:CCGGCCCACGAATAGACACGCATTTCTCGAGAAATGCGTGTCTATTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-569s21c1
Sequence:CCGGGGAAGGCACATCAGTTCTAAGCTCGAGCTTAGAACTGATGTGCCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008622
VALIDATED
MPV17 MISSION shRNA shRNA Plasmid DNA
MpV17 mitochondrial inner membrane protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-837s1c1
Sequence:CCGGCCCACGAATAGACACGCATTTCTCGAGAAATGCGTGTCTATTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-368s1c1
Sequence:CCGGTGGTCGGGATACTCAATGGAACTCGAGTTCCATTGAGTATCCCGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-115s1c1
Sequence:CCGGGCTGGATCACTGATGGGCGTACTCGAGTACGCCCATCAGTGATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-377s21c1
Sequence:CCGGTGGTCGGGATACTCAATGGAACTCGAGTTCCATTGAGTATCCCGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-446s21c1
Sequence:CCGGCCCTCATCACCAACTACTATCCTCGAGGATAGTAGTTGGTGATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-526s21c1
Sequence:CCGGGTTGTCCAGTGTGTTGCTATTCTCGAGAATAGCAACACACTGGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008622.5-846s21c1
Sequence:CCGGCCCACGAATAGACACGCATTTCTCGAGAAATGCGTGTCTATTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-569s21c1
Sequence:CCGGGGAAGGCACATCAGTTCTAAGCTCGAGCTTAGAACTGATGTGCCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008622
VALIDATED
MPV17 MISSION shRNA Lentiviral Transduction Particles
MpV17 mitochondrial inner membrane protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-837s1c1
Sequence:CCGGCCCACGAATAGACACGCATTTCTCGAGAAATGCGTGTCTATTCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-368s1c1
Sequence:CCGGTGGTCGGGATACTCAATGGAACTCGAGTTCCATTGAGTATCCCGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008622.1-115s1c1
Sequence:CCGGGCTGGATCACTGATGGGCGTACTCGAGTACGCCCATCAGTGATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-377s21c1
Sequence:CCGGTGGTCGGGATACTCAATGGAACTCGAGTTCCATTGAGTATCCCGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-446s21c1
Sequence:CCGGCCCTCATCACCAACTACTATCCTCGAGGATAGTAGTTGGTGATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-526s21c1
Sequence:CCGGGTTGTCCAGTGTGTTGCTATTCTCGAGAATAGCAACACACTGGACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008622.5-846s21c1
Sequence:CCGGCCCACGAATAGACACGCATTTCTCGAGAAATGCGTGTCTATTCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008622.5-569s21c1
Sequence:CCGGGGAAGGCACATCAGTTCTAAGCTCGAGCTTAGAACTGATGTGCCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002437
VALIDATED
MPV17 MISSION shRNA Bacterial Glycerol Stock
MpV17 mitochondrial inner membrane protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-470s1c1
Sequence:CCGGGCAGTTAGCCAACTTCTACCTCTCGAGAGGTAGAAGTTGGCTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-757s1c1
Sequence:CCGGGAGCCCTTGATAATAGTCTTACTCGAGTAAGACTATTATCAAGGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-303s1c1
Sequence:CCGGCTGAAGAAGATGTTGTTGGATCTCGAGATCCAACAACATCTTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-521s1c1
Sequence:CCGGCCAATGTGTTGCTGTTATCTGCTCGAGCAGATAACAGCAACACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002437.3-498s1c1
Sequence:CCGGCTTCATTACAGGTTGGCCGTTCTCGAGAACGGCCAACCTGTAATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002437.4-766s21c1
Sequence:CCGGGAGCCCTTGATAATAGTCTTACTCGAGTAAGACTATTATCAAGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-479s21c1
Sequence:CCGGGCAGTTAGCCAACTTCTACCTCTCGAGAGGTAGAAGTTGGCTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-530s21c1
Sequence:CCGGCCAATGTGTTGCTGTTATCTGCTCGAGCAGATAACAGCAACACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-312s21c1
Sequence:CCGGCTGAAGAAGATGTTGTTGGATCTCGAGATCCAACAACATCTTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002437
VALIDATED
MPV17 MISSION shRNA shRNA Plasmid DNA
MpV17 mitochondrial inner membrane protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-470s1c1
Sequence:CCGGGCAGTTAGCCAACTTCTACCTCTCGAGAGGTAGAAGTTGGCTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-757s1c1
Sequence:CCGGGAGCCCTTGATAATAGTCTTACTCGAGTAAGACTATTATCAAGGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-303s1c1
Sequence:CCGGCTGAAGAAGATGTTGTTGGATCTCGAGATCCAACAACATCTTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-521s1c1
Sequence:CCGGCCAATGTGTTGCTGTTATCTGCTCGAGCAGATAACAGCAACACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002437.3-498s1c1
Sequence:CCGGCTTCATTACAGGTTGGCCGTTCTCGAGAACGGCCAACCTGTAATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002437.4-766s21c1
Sequence:CCGGGAGCCCTTGATAATAGTCTTACTCGAGTAAGACTATTATCAAGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-479s21c1
Sequence:CCGGGCAGTTAGCCAACTTCTACCTCTCGAGAGGTAGAAGTTGGCTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-530s21c1
Sequence:CCGGCCAATGTGTTGCTGTTATCTGCTCGAGCAGATAACAGCAACACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-312s21c1
Sequence:CCGGCTGAAGAAGATGTTGTTGGATCTCGAGATCCAACAACATCTTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002437
VALIDATED
MPV17 MISSION shRNA Lentiviral Transduction Particles
MpV17 mitochondrial inner membrane protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-470s1c1
Sequence:CCGGGCAGTTAGCCAACTTCTACCTCTCGAGAGGTAGAAGTTGGCTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-757s1c1
Sequence:CCGGGAGCCCTTGATAATAGTCTTACTCGAGTAAGACTATTATCAAGGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-303s1c1
Sequence:CCGGCTGAAGAAGATGTTGTTGGATCTCGAGATCCAACAACATCTTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002437.3-521s1c1
Sequence:CCGGCCAATGTGTTGCTGTTATCTGCTCGAGCAGATAACAGCAACACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002437.3-498s1c1
Sequence:CCGGCTTCATTACAGGTTGGCCGTTCTCGAGAACGGCCAACCTGTAATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002437.4-766s21c1
Sequence:CCGGGAGCCCTTGATAATAGTCTTACTCGAGTAAGACTATTATCAAGGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-479s21c1
Sequence:CCGGGCAGTTAGCCAACTTCTACCTCTCGAGAGGTAGAAGTTGGCTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-530s21c1
Sequence:CCGGCCAATGTGTTGCTGTTATCTGCTCGAGCAGATAACAGCAACACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002437.4-312s21c1
Sequence:CCGGCTGAAGAAGATGTTGTTGGATCTCGAGATCCAACAACATCTTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)