EMAIL THIS PAGE TO A FRIEND

MPV17L

MPV17 mitochondrial membrane protein-like

103 Gene Product Result for
Synonyms: M-LPH MLPH1 MLPH2 MPV17L1
UniProtKB ID: Q2QL34, B4DDY1, Q6P7T6, Q8N8E9
Gene ID:
Mouse(93734) Mpv17 transgene, kidney disease mutant-like
Rat(360463) MPV17 mitochondrial membrane protein-like
domestic guinea pig(100715739) MPV17 mitochondrial membrane protein-like
sheep(101113900) MPV17 mitochondrial membrane protein-like
dog(100684093) MPV17 mitochondrial membrane protein-like
cow(617491) MPV17 mitochondrial membrane protein-like
domestic cat(101080348) MPV17 mitochondrial membrane protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173803 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128423 Rosetta Predictions human pricing
NM_173803 Rosetta Predictions human pricing
NM_001098240 Rosetta Predictions rat pricing
XM_340739 Rosetta Predictions rat pricing
NM_033564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331116 predicted 308
2 SASI_Hs02_00331117 predicted 540
3 SASI_Hs02_00331118 predicted 841
4 SASI_Hs02_00331119 predicted 746
5 SASI_Hs02_00331120 predicted 718
6 SASI_Hs02_00331121 predicted 644
7 SASI_Hs02_00331122 predicted 466
8 SASI_Hs02_00331123 predicted 564
9 SASI_Hs02_00331124 predicted 905
10 SASI_Hs02_00331125 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368661 predicted 446
2 SASI_Hs01_00169173 predicted 750
3 SASI_Hs01_00169174 predicted 649
4 SASI_Hs01_00169175 predicted 625
5 SASI_Hs01_00169176 predicted 547
6 SASI_Hs01_00169177 predicted 434
7 SASI_Hs01_00169178 predicted 430
8 SASI_Hs01_00169179 predicted 463
9 SASI_Hs01_00169180 predicted 266
10 SASI_Hs01_00169181 predicted 410
11 SASI_Hs01_00169182 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209111 predicted 484
2 SASI_Rn02_00209112 predicted 299
3 SASI_Rn02_00209113 predicted 318
4 SASI_Rn02_00209114 predicted 841
5 SASI_Rn02_00209115 predicted 633
6 SASI_Rn02_00209116 predicted 500
7 SASI_Rn02_00209117 predicted 381
8 SASI_Rn02_00209118 predicted 790
9 SASI_Rn02_00209119 predicted 848
10 SASI_Rn02_00209120 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190122 predicted 328
2 SASI_Rn01_00190123 predicted 363
3 SASI_Rn01_00190124 predicted 606
4 SASI_Rn01_00190125 predicted 649
5 SASI_Rn01_00190126 predicted 353
6 SASI_Rn01_00190127 predicted 518
7 SASI_Rn01_00190128 predicted 375
8 SASI_Rn01_00190129 predicted 666
9 SASI_Rn01_00190130 predicted 451
10 SASI_Rn01_00190131 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115377 predicted 202
2 SASI_Mm02_00337393 predicted 533
3 SASI_Mm01_00115379 predicted 267
4 SASI_Mm01_00115380 predicted 413
5 SASI_Mm01_00115381 predicted 378
6 SASI_Mm01_00115382 predicted 604
7 SASI_Mm02_00337394 predicted 397
8 SASI_Mm01_00115384 predicted 614
9 SASI_Mm01_00115385 predicted 677
10 SASI_Mm01_00115386 predicted 524
11 SASI_Mm01_00115378 predicted 571
12 SASI_Mm01_00115383 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033564
MPV17L MISSION shRNA Bacterial Glycerol Stock
MPV17 mitochondrial membrane protein-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033564.2-927s21c1
Sequence:CCGGAGATTGTATTTCTAGCCTAAACTCGAGTTTAGGCTAGAAATACAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033564.2-407s21c1
Sequence:CCGGCTCATGTACTGGCCCTTTGTGCTCGAGCACAAAGGGCCAGTACATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033564.2-1024s21c1
Sequence:CCGGTCAGTCATGAAGGTTGAATAACTCGAGTTATTCAACCTTCATGACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033564.1-719s1c1
Sequence:CCGGGCCCACTTGATTTGAAATTATCTCGAGATAATTTCAAATCAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-193s1c1
Sequence:CCGGCCACGGAAACTTCAACTACGTCTCGAGACGTAGTTGAAGTTTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-70s1c1
Sequence:CCGGGCCCACTAACGTGCTGCTCTACTCGAGTAGAGCAGCACGTTAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-545s1c1
Sequence:CCGGCAGTCCATATTCATCTTCCTTCTCGAGAAGGAAGATGAATATGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-376s1c1
Sequence:CCGGGCAGAAATTCTGGAATACGTACTCGAGTACGTATTCCAGAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033564
MPV17L MISSION shRNA shRNA Plasmid DNA
MPV17 mitochondrial membrane protein-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033564.2-927s21c1
Sequence:CCGGAGATTGTATTTCTAGCCTAAACTCGAGTTTAGGCTAGAAATACAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033564.2-407s21c1
Sequence:CCGGCTCATGTACTGGCCCTTTGTGCTCGAGCACAAAGGGCCAGTACATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033564.2-1024s21c1
Sequence:CCGGTCAGTCATGAAGGTTGAATAACTCGAGTTATTCAACCTTCATGACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033564.1-719s1c1
Sequence:CCGGGCCCACTTGATTTGAAATTATCTCGAGATAATTTCAAATCAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-193s1c1
Sequence:CCGGCCACGGAAACTTCAACTACGTCTCGAGACGTAGTTGAAGTTTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-70s1c1
Sequence:CCGGGCCCACTAACGTGCTGCTCTACTCGAGTAGAGCAGCACGTTAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-545s1c1
Sequence:CCGGCAGTCCATATTCATCTTCCTTCTCGAGAAGGAAGATGAATATGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-376s1c1
Sequence:CCGGGCAGAAATTCTGGAATACGTACTCGAGTACGTATTCCAGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033564
MPV17L MISSION shRNA Lentiviral Transduction Particles
MPV17 mitochondrial membrane protein-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033564.2-927s21c1
Sequence:CCGGAGATTGTATTTCTAGCCTAAACTCGAGTTTAGGCTAGAAATACAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033564.2-407s21c1
Sequence:CCGGCTCATGTACTGGCCCTTTGTGCTCGAGCACAAAGGGCCAGTACATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033564.2-1024s21c1
Sequence:CCGGTCAGTCATGAAGGTTGAATAACTCGAGTTATTCAACCTTCATGACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033564.1-719s1c1
Sequence:CCGGGCCCACTTGATTTGAAATTATCTCGAGATAATTTCAAATCAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-193s1c1
Sequence:CCGGCCACGGAAACTTCAACTACGTCTCGAGACGTAGTTGAAGTTTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-70s1c1
Sequence:CCGGGCCCACTAACGTGCTGCTCTACTCGAGTAGAGCAGCACGTTAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-545s1c1
Sequence:CCGGCAGTCCATATTCATCTTCCTTCTCGAGAAGGAAGATGAATATGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033564.1-376s1c1
Sequence:CCGGGCAGAAATTCTGGAATACGTACTCGAGTACGTATTCCAGAATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173803
MPV17L MISSION shRNA Bacterial Glycerol Stock
MPV17 mitochondrial membrane protein-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-449s1c1
Sequence:CCGGCCTTTGTACAGCTGACCAACTCTCGAGAGTTGGTCAGCTGTACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-426s1c1
Sequence:CCGGGTCGAGTGGATTGATGTACTGCTCGAGCAGTACATCAATCCACTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-299s1c1
Sequence:CCGGCAACTTCAACTACGTGTGGCTCTCGAGAGCCACACGTAGTTGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-481s1c1
Sequence:CCGGCCTGTTCAATGGAGAACAGCTCTCGAGAGCTGTTCTCCATTGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173803.2-564s1c1
Sequence:CCGGCGGCACATTCAAGTCAGCTTTCTCGAGAAAGCTGACTTGAATGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-487s1c1
Sequence:CCGGCAATGGAGAACAGCTTACGCTCTCGAGAGCGTAAGCTGTTCTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-290s1c1
Sequence:CCGGCTTCCACGCCAACTTCAACTACTCGAGTAGTTGAAGTTGGCGTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173803.2-1841s1c1
Sequence:CCGGGCTCAAGCTAAGCCATCATATCTCGAGATATGATGGCTTAGCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173803
MPV17L MISSION shRNA shRNA Plasmid DNA
MPV17 mitochondrial membrane protein-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-449s1c1
Sequence:CCGGCCTTTGTACAGCTGACCAACTCTCGAGAGTTGGTCAGCTGTACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-426s1c1
Sequence:CCGGGTCGAGTGGATTGATGTACTGCTCGAGCAGTACATCAATCCACTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-299s1c1
Sequence:CCGGCAACTTCAACTACGTGTGGCTCTCGAGAGCCACACGTAGTTGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-481s1c1
Sequence:CCGGCCTGTTCAATGGAGAACAGCTCTCGAGAGCTGTTCTCCATTGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173803.2-564s1c1
Sequence:CCGGCGGCACATTCAAGTCAGCTTTCTCGAGAAAGCTGACTTGAATGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-487s1c1
Sequence:CCGGCAATGGAGAACAGCTTACGCTCTCGAGAGCGTAAGCTGTTCTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-290s1c1
Sequence:CCGGCTTCCACGCCAACTTCAACTACTCGAGTAGTTGAAGTTGGCGTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173803.2-1841s1c1
Sequence:CCGGGCTCAAGCTAAGCCATCATATCTCGAGATATGATGGCTTAGCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173803
MPV17L MISSION shRNA Lentiviral Transduction Particles
MPV17 mitochondrial membrane protein-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-449s1c1
Sequence:CCGGCCTTTGTACAGCTGACCAACTCTCGAGAGTTGGTCAGCTGTACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-426s1c1
Sequence:CCGGGTCGAGTGGATTGATGTACTGCTCGAGCAGTACATCAATCCACTCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-299s1c1
Sequence:CCGGCAACTTCAACTACGTGTGGCTCTCGAGAGCCACACGTAGTTGAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-481s1c1
Sequence:CCGGCCTGTTCAATGGAGAACAGCTCTCGAGAGCTGTTCTCCATTGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173803.2-564s1c1
Sequence:CCGGCGGCACATTCAAGTCAGCTTTCTCGAGAAAGCTGACTTGAATGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173803.2-487s1c1
Sequence:CCGGCAATGGAGAACAGCTTACGCTCTCGAGAGCGTAAGCTGTTCTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173803.2-290s1c1
Sequence:CCGGCTTCCACGCCAACTTCAACTACTCGAGTAGTTGAAGTTGGCGTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173803.2-1841s1c1
Sequence:CCGGGCTCAAGCTAAGCCATCATATCTCGAGATATGATGGCTTAGCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)