EMAIL THIS PAGE TO A FRIEND

MPZ

myelin protein zero

214 Gene Product Result for
Synonyms: CHM CMT1 CMT1B CMT2I CMT2J CMT4E CMTDI3 CMTDID DSS HMSNIB MPP P0
UniProtKB ID: P25189, Q16072, Q5VTH4, Q92677, Q9BR67
Gene ID:
Human(4359) Summary: This gene encodes a major structural protein of peripheral myelin. Mutations in this gene result in the autosomal dominant form of Charcot-Marie-Tooth disease type 1 and other polyneuropathies. [provided by RefSeq, Apr 2010]
Mouse(17528) myelin protein zero
Rat(24564) myelin protein zero
sheep(101106820) myelin protein zero
naked mole-rat(101698680) myelin protein zero
domestic guinea pig(100714560) myelin protein zero
Zebrafish(114417) myelin protein zero
cow(539462) myelin protein zero
Horse(100034024) myelin protein zero
domestic cat(101088210) myelin protein zero
dog(488654) myelin protein zero
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000530 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000530 Rosetta Predictions human pricing
NM_017027 Rosetta Predictions rat pricing
NM_008623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072450 predicted 453
2 SASI_Hs01_00072451 predicted 422
3 SASI_Hs01_00072452 predicted 221
4 SASI_Hs01_00072453 predicted 266
5 SASI_Hs01_00072456 predicted 854
6 SASI_Hs01_00072457 predicted 780
7 SASI_Hs01_00072458 predicted 735
8 SASI_Hs01_00072459 predicted 514
9 SASI_Hs02_00302738 predicted 464
10 SASI_Hs02_00302739 predicted 681
11 SASI_Hs01_00072454 predicted 280
12 SASI_Hs01_00072455 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053850 predicted 193
2 SASI_Rn01_00053851 predicted 422
3 SASI_Rn01_00053852 predicted 279
4 SASI_Rn01_00053853 predicted 249
5 SASI_Rn01_00053854 predicted 721
6 SASI_Rn01_00053855 predicted 434
7 SASI_Rn01_00053856 predicted 254
8 SASI_Rn01_00053857 predicted 706
9 SASI_Rn01_00053858 predicted 438
10 SASI_Rn02_00261204 predicted 307
11 SASI_Rn01_00053849 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140707 predicted 987
2 SASI_Mm02_00314313 predicted 377
3 SASI_Mm01_00140708 predicted 967
4 SASI_Mm01_00140712 predicted 564
5 SASI_Mm02_00314314 predicted 388
6 SASI_Mm01_00140709 predicted 242
7 SASI_Mm02_00314315 predicted 388
8 SASI_Mm01_00140710 predicted 889
9 SASI_Mm01_00140711 predicted 327
10 SASI_Mm02_00314316 predicted 414
11 SASI_Mm01_00140713 predicted 973
12 SASI_Mm01_00140714 predicted 591
13 SASI_Mm01_00140715 predicted 1064
14 SASI_Mm01_00140716 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008623
MPZ MISSION shRNA Bacterial Glycerol Stock
myelin protein zero
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008623.4-1252s21c1
Sequence:CCGGTGTACTCCTCCTTCGCCTTTACTCGAGTAAAGGCGAAGGAGGAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008623.4-1211s21c1
Sequence:CCGGATGAGATGTAAAGTTTCATTCCTCGAGGAATGAAACTTTACATCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008623.4-891s21c1
Sequence:CCGGAGTCTCGCAAGGATAAGAAATCTCGAGATTTCTTATCCTTGCGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-595s1c1
Sequence:CCGGTCACGCTCTATGTCTTTGAAACTCGAGTTTCAAAGACATAGAGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008623.2-1590s1c1
Sequence:CCGGCCATCCATTCTTTCGTTTGTTCTCGAGAACAAACGAAAGAATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-692s1c1
Sequence:CCGGGCTCTTCTACCTGATTCGGTACTCGAGTACCGAATCAGGTAGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-515s1c1
Sequence:CCGGCAACCTAGACTACAGTGACAACTCGAGTTGTCACTGTAGTCTAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-388s1c1
Sequence:CCGGGCCGAGATGCCATTTCGATTTCTCGAGAAATCGAAATGGCATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008623.4-264s21c1
Sequence:CCGGACACGGACAGGGAAATCTATGCTCGAGCATAGATTTCCCTGTCCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008623
MPZ MISSION shRNA shRNA Plasmid DNA
myelin protein zero
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008623.4-1252s21c1
Sequence:CCGGTGTACTCCTCCTTCGCCTTTACTCGAGTAAAGGCGAAGGAGGAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008623.4-1211s21c1
Sequence:CCGGATGAGATGTAAAGTTTCATTCCTCGAGGAATGAAACTTTACATCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008623.4-891s21c1
Sequence:CCGGAGTCTCGCAAGGATAAGAAATCTCGAGATTTCTTATCCTTGCGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-595s1c1
Sequence:CCGGTCACGCTCTATGTCTTTGAAACTCGAGTTTCAAAGACATAGAGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008623.2-1590s1c1
Sequence:CCGGCCATCCATTCTTTCGTTTGTTCTCGAGAACAAACGAAAGAATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-692s1c1
Sequence:CCGGGCTCTTCTACCTGATTCGGTACTCGAGTACCGAATCAGGTAGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-515s1c1
Sequence:CCGGCAACCTAGACTACAGTGACAACTCGAGTTGTCACTGTAGTCTAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-388s1c1
Sequence:CCGGGCCGAGATGCCATTTCGATTTCTCGAGAAATCGAAATGGCATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008623.4-264s21c1
Sequence:CCGGACACGGACAGGGAAATCTATGCTCGAGCATAGATTTCCCTGTCCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008623
MPZ MISSION shRNA Lentiviral Transduction Particles
myelin protein zero
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008623.4-1252s21c1
Sequence:CCGGTGTACTCCTCCTTCGCCTTTACTCGAGTAAAGGCGAAGGAGGAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008623.4-1211s21c1
Sequence:CCGGATGAGATGTAAAGTTTCATTCCTCGAGGAATGAAACTTTACATCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008623.4-891s21c1
Sequence:CCGGAGTCTCGCAAGGATAAGAAATCTCGAGATTTCTTATCCTTGCGAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-595s1c1
Sequence:CCGGTCACGCTCTATGTCTTTGAAACTCGAGTTTCAAAGACATAGAGCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008623.2-1590s1c1
Sequence:CCGGCCATCCATTCTTTCGTTTGTTCTCGAGAACAAACGAAAGAATGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-692s1c1
Sequence:CCGGGCTCTTCTACCTGATTCGGTACTCGAGTACCGAATCAGGTAGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-515s1c1
Sequence:CCGGCAACCTAGACTACAGTGACAACTCGAGTTGTCACTGTAGTCTAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008623.2-388s1c1
Sequence:CCGGGCCGAGATGCCATTTCGATTTCTCGAGAAATCGAAATGGCATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008623.4-264s21c1
Sequence:CCGGACACGGACAGGGAAATCTATGCTCGAGCATAGATTTCCCTGTCCGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000530
MPZ MISSION shRNA Bacterial Glycerol Stock
myelin protein zero
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-275s1c1
Sequence:CCGGGCCATTTCGATCTTCCACTATCTCGAGATAGTGGAAGATCGAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-473s1c1
Sequence:CCGGGTCACGCTGTATGTCTTTGAACTCGAGTTCAAAGACATACAGCGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-474s1c1
Sequence:CCGGTCACGCTGTATGTCTTTGAAACTCGAGTTTCAAAGACATACAGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000530.3-1095s1c1
Sequence:CCGGCCTCCCTTTGAGATGTAAGTTCTCGAGAACTTACATCTCAAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-773s1c1
Sequence:CCGGGAGTCTCGCAAGGATAAGAAACTCGAGTTTCTTATCCTTGCGAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000530
MPZ MISSION shRNA shRNA Plasmid DNA
myelin protein zero
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-275s1c1
Sequence:CCGGGCCATTTCGATCTTCCACTATCTCGAGATAGTGGAAGATCGAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-473s1c1
Sequence:CCGGGTCACGCTGTATGTCTTTGAACTCGAGTTCAAAGACATACAGCGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-474s1c1
Sequence:CCGGTCACGCTGTATGTCTTTGAAACTCGAGTTTCAAAGACATACAGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000530.3-1095s1c1
Sequence:CCGGCCTCCCTTTGAGATGTAAGTTCTCGAGAACTTACATCTCAAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-773s1c1
Sequence:CCGGGAGTCTCGCAAGGATAAGAAACTCGAGTTTCTTATCCTTGCGAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000530
MPZ MISSION shRNA Lentiviral Transduction Particles
myelin protein zero
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-275s1c1
Sequence:CCGGGCCATTTCGATCTTCCACTATCTCGAGATAGTGGAAGATCGAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-473s1c1
Sequence:CCGGGTCACGCTGTATGTCTTTGAACTCGAGTTCAAAGACATACAGCGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-474s1c1
Sequence:CCGGTCACGCTGTATGTCTTTGAAACTCGAGTTTCAAAGACATACAGCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000530.3-1095s1c1
Sequence:CCGGCCTCCCTTTGAGATGTAAGTTCTCGAGAACTTACATCTCAAAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000530.3-773s1c1
Sequence:CCGGGAGTCTCGCAAGGATAAGAAACTCGAGTTTCTTATCCTTGCGAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)