EMAIL THIS PAGE TO A FRIEND

MPZL1

myelin protein zero-like 1

161 Gene Product Result for
Synonyms: MPZL1b PZR PZR1b PZRa PZRb
Gene ID:
Mouse(68481) myelin protein zero-like 1
Rat(360871) myelin protein zero-like 1
chicken(418441) myelin protein zero-like 1
domestic cat(101098843) myelin protein zero-like 1
cow(539387) myelin protein zero-like 1
dog(480088) myelin protein zero-like 1
domestic guinea pig(100721149) myelin protein zero-like 1
naked mole-rat(101724283) myelin protein zero-like 1
sheep(101115590) myelin protein zero-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024569 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003953 Rosetta Predictions human pricing
NM_024569 Rosetta Predictions human pricing
NM_001007728 Rosetta Predictions rat pricing
NM_001001880 Rosetta Predictions mouse pricing
NM_001083897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216097 predicted 1475
2 SASI_Hs01_00216098 predicted 1139
3 SASI_Hs01_00216099 predicted 1284
4 SASI_Hs01_00216100 predicted 1257
5 SASI_Hs01_00216101 predicted 471
6 SASI_Hs01_00216102 predicted 1293
7 SASI_Hs01_00216103 predicted 1390
8 SASI_Hs01_00216104 predicted 553
9 SASI_Hs01_00216105 predicted 1466
10 SASI_Hs01_00216106 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356883 predicted 1032
2 SASI_Hs01_00212810 predicted 1277
3 SASI_Hs01_00212811 predicted 1221
4 SASI_Hs01_00212813 predicted 1174
5 SASI_Hs01_00212814 predicted 1158
6 SASI_Hs01_00212816 predicted 1182
7 SASI_Hs01_00212817 predicted 1282
8 SASI_Hs01_00212818 predicted 1280
9 SASI_Hs01_00212819 predicted 554
10 SASI_Hs02_00356884 predicted 1154
11 SASI_Hs01_00212812 predicted 1034
12 SASI_Hs01_00212815 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198913 predicted 685
2 SASI_Rn01_00076165 predicted 1111
3 SASI_Rn01_00076166 predicted 1041
4 SASI_Rn01_00076167 predicted 840
5 SASI_Rn01_00076168 predicted 234
6 SASI_Rn01_00076169 predicted 1098
7 SASI_Rn01_00076170 predicted 261
8 SASI_Rn01_00076171 predicted 462
9 SASI_Rn01_00076172 predicted 1029
10 SASI_Rn01_00076173 predicted 675
11 SASI_Rn01_00076174 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193510 predicted 1040
2 SASI_Mm01_00193511 predicted 1029
3 SASI_Mm01_00193512 predicted 973
4 SASI_Mm02_00286222 predicted 977
5 SASI_Mm02_00286223 predicted 1253
6 SASI_Mm02_00286224 predicted 1139
7 SASI_Mm01_00193513 predicted 230
8 SASI_Mm02_00286225 predicted 1216
9 SASI_Mm01_00193515 predicted 1023
10 SASI_Mm02_00286226 predicted 1275
11 SASI_Mm01_00193514 predicted 869
12 SASI_Mm01_00193516 predicted 859
13 SASI_Mm01_00193517 predicted 848
14 SASI_Mm01_00193518 predicted 1057
15 SASI_Mm01_00193519 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299891 predicted 1145
2 SASI_Mm02_00299892 predicted 1135
3 SASI_Mm02_00299893 predicted 1083
4 SASI_Mm02_00299894 predicted 1079
5 SASI_Mm02_00299895 predicted 284
6 SASI_Mm02_00299896 predicted 1246
7 SASI_Mm02_00299897 predicted 226
8 SASI_Mm02_00299898 predicted 1127
9 SASI_Mm02_00299899 predicted 1154
10 SASI_Mm02_00299900 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001880
VALIDATED
MPZL1 MISSION shRNA Bacterial Glycerol Stock
myelin protein zero-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000091519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-752s1c1
Sequence:CCGGCCAGTCATTTACGCACAGTTACTCGAGTAACTGTGCGTAAATGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001880.1-263s1c1
Sequence:CCGGCCATACTCCTAAAGAAATCTTCTCGAGAAGATTTCTTTAGGAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-319s1c1
Sequence:CCGGCATTCGATTCTCCTAACACAACTCGAGTTGTGTTAGGAGAATCGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-523s1c1
Sequence:CCGGCTGTTCACAATGGCACCTATACTCGAGTATAGGTGCCATTGTGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001880
VALIDATED
MPZL1 MISSION shRNA shRNA Plasmid DNA
myelin protein zero-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000091519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-752s1c1
Sequence:CCGGCCAGTCATTTACGCACAGTTACTCGAGTAACTGTGCGTAAATGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001880.1-263s1c1
Sequence:CCGGCCATACTCCTAAAGAAATCTTCTCGAGAAGATTTCTTTAGGAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-319s1c1
Sequence:CCGGCATTCGATTCTCCTAACACAACTCGAGTTGTGTTAGGAGAATCGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-523s1c1
Sequence:CCGGCTGTTCACAATGGCACCTATACTCGAGTATAGGTGCCATTGTGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001880
VALIDATED
MPZL1 MISSION shRNA Lentiviral Transduction Particles
myelin protein zero-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000091519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-752s1c1
Sequence:CCGGCCAGTCATTTACGCACAGTTACTCGAGTAACTGTGCGTAAATGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001880.1-263s1c1
Sequence:CCGGCCATACTCCTAAAGAAATCTTCTCGAGAAGATTTCTTTAGGAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-319s1c1
Sequence:CCGGCATTCGATTCTCCTAACACAACTCGAGTTGTGTTAGGAGAATCGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001880.1-523s1c1
Sequence:CCGGCTGTTCACAATGGCACCTATACTCGAGTATAGGTGCCATTGTGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024569
VALIDATED
MPZL1 MISSION shRNA Bacterial Glycerol Stock
myelin protein zero-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-2291s1c1
Sequence:CCGGGCCCACAGTTATGGAAAGAATCTCGAGATTCTTTCCATAACTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024569.3-291s1c1
Sequence:CCGGCCTTGGAAGTATATACGCCAACTCGAGTTGGCGTATATACTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024569.3-422s1c1
Sequence:CCGGGCCGACACTACTGTGTCGTTTCTCGAGAAACGACACAGTAGTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-719s1c1
Sequence:CCGGACTCTGCTCATCAGCATGATTCTCGAGAATCATGCTGATGAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-790s1c1
Sequence:CCGGCCAGTCATATATGCACAGTTACTCGAGTAACTGTGCATATATGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-714s21c1
Sequence:CCGGTAGTTACTGCTGTGGTCCTAGCTCGAGCTAGGACCACAGCAGTAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-703s21c1
Sequence:CCGGAGTGGTGGGCATAGTTACTGCCTCGAGGCAGTAACTATGCCCACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024569.4-312s21c1
Sequence:CCGGCCTTGGAAGTATATACGCCAACTCGAGTTGGCGTATATACTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-2312s21c1
Sequence:CCGGGCCCACAGTTATGGAAAGAATCTCGAGATTCTTTCCATAACTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-740s21c1
Sequence:CCGGACTCTGCTCATCAGCATGATTCTCGAGAATCATGCTGATGAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024569
VALIDATED
MPZL1 MISSION shRNA shRNA Plasmid DNA
myelin protein zero-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-2291s1c1
Sequence:CCGGGCCCACAGTTATGGAAAGAATCTCGAGATTCTTTCCATAACTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024569.3-291s1c1
Sequence:CCGGCCTTGGAAGTATATACGCCAACTCGAGTTGGCGTATATACTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024569.3-422s1c1
Sequence:CCGGGCCGACACTACTGTGTCGTTTCTCGAGAAACGACACAGTAGTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-719s1c1
Sequence:CCGGACTCTGCTCATCAGCATGATTCTCGAGAATCATGCTGATGAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-790s1c1
Sequence:CCGGCCAGTCATATATGCACAGTTACTCGAGTAACTGTGCATATATGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-714s21c1
Sequence:CCGGTAGTTACTGCTGTGGTCCTAGCTCGAGCTAGGACCACAGCAGTAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-703s21c1
Sequence:CCGGAGTGGTGGGCATAGTTACTGCCTCGAGGCAGTAACTATGCCCACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024569.4-312s21c1
Sequence:CCGGCCTTGGAAGTATATACGCCAACTCGAGTTGGCGTATATACTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-2312s21c1
Sequence:CCGGGCCCACAGTTATGGAAAGAATCTCGAGATTCTTTCCATAACTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-740s21c1
Sequence:CCGGACTCTGCTCATCAGCATGATTCTCGAGAATCATGCTGATGAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024569
VALIDATED
MPZL1 MISSION shRNA Lentiviral Transduction Particles
myelin protein zero-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-2291s1c1
Sequence:CCGGGCCCACAGTTATGGAAAGAATCTCGAGATTCTTTCCATAACTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024569.3-291s1c1
Sequence:CCGGCCTTGGAAGTATATACGCCAACTCGAGTTGGCGTATATACTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024569.3-422s1c1
Sequence:CCGGGCCGACACTACTGTGTCGTTTCTCGAGAAACGACACAGTAGTGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-719s1c1
Sequence:CCGGACTCTGCTCATCAGCATGATTCTCGAGAATCATGCTGATGAGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024569.3-790s1c1
Sequence:CCGGCCAGTCATATATGCACAGTTACTCGAGTAACTGTGCATATATGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-714s21c1
Sequence:CCGGTAGTTACTGCTGTGGTCCTAGCTCGAGCTAGGACCACAGCAGTAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-703s21c1
Sequence:CCGGAGTGGTGGGCATAGTTACTGCCTCGAGGCAGTAACTATGCCCACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024569.4-312s21c1
Sequence:CCGGCCTTGGAAGTATATACGCCAACTCGAGTTGGCGTATATACTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-2312s21c1
Sequence:CCGGGCCCACAGTTATGGAAAGAATCTCGAGATTCTTTCCATAACTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024569.4-740s21c1
Sequence:CCGGACTCTGCTCATCAGCATGATTCTCGAGAATCATGCTGATGAGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)