EMAIL THIS PAGE TO A FRIEND

MPZL3

myelin protein zero-like 3

64 Gene Product Result for
UniProtKB ID: Q6UWV2, A8K025
Gene ID:
Mouse(319742) myelin protein zero-like 3
Rat(363054) myelin protein zero-like 3
Zebrafish(406448) myelin protein zero-like 3
cow(521837) myelin protein zero-like 3
domestic cat(101088779) myelin protein zero-like 3
dog(489385) myelin protein zero-like 3
chicken(419778) myelin protein zero-like 3
domestic guinea pig(100726953) myelin protein zero-like 3
naked mole-rat(101710486) myelin protein zero-like 3
sheep(101122547) myelin protein zero-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198275 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036171 MISSION® esiRNA esiRNA human MPZL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198275 Rosetta Predictions human pricing
NM_001108760 Rosetta Predictions rat pricing
XM_343381 Rosetta Predictions rat pricing
NM_001093749 Rosetta Predictions mouse pricing
NM_176993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079359 predicted 279
2 SASI_Hs01_00079360 predicted 680
3 SASI_Hs01_00079361 predicted 584
4 SASI_Hs01_00079362 predicted 429
5 SASI_Hs01_00079363 predicted 412
6 SASI_Hs01_00079364 predicted 737
7 SASI_Hs01_00079365 predicted 706
8 SASI_Hs01_00079366 predicted 653
9 SASI_Hs01_00079367 predicted 398
10 SASI_Hs01_00079368 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241815 predicted 282
2 SASI_Rn02_00241816 predicted 635
3 SASI_Rn02_00241817 predicted 885
4 SASI_Rn02_00241818 predicted 787
5 SASI_Rn02_00241819 predicted 881
6 SASI_Rn02_00241820 predicted 849
7 SASI_Rn02_00241821 predicted 744
8 SASI_Rn02_00241822 predicted 873
9 SASI_Rn02_00241823 predicted 779
10 SASI_Rn02_00241824 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141458 predicted 858
2 SASI_Rn01_00141459 predicted 864
3 SASI_Rn01_00141460 predicted 776
4 SASI_Rn01_00141461 predicted 722
5 SASI_Rn01_00141462 predicted 837
6 SASI_Rn01_00141463 predicted 750
7 SASI_Rn01_00141464 predicted 726
8 SASI_Rn01_00141465 predicted 762
9 SASI_Rn01_00141466 predicted 748
10 SASI_Rn01_00141467 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301029 predicted 607
2 SASI_Mm02_00301030 predicted 319
3 SASI_Mm02_00301031 predicted 199
4 SASI_Mm02_00301032 predicted 449
5 SASI_Mm02_00301033 predicted 210
6 SASI_Mm02_00301034 predicted 448
7 SASI_Mm02_00301035 predicted 452
8 SASI_Mm02_00301036 predicted 317
9 SASI_Mm02_00301037 predicted 306
10 SASI_Mm02_00301038 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079155 predicted 763
2 SASI_Mm01_00079156 predicted 495
3 SASI_Mm01_00079157 predicted 391
4 SASI_Mm01_00079159 predicted 235
5 SASI_Mm01_00079160 predicted 411
6 SASI_Mm01_00079162 predicted 751
7 SASI_Mm01_00079163 predicted 779
8 SASI_Mm02_00346917 predicted 389
9 SASI_Mm01_00079164 predicted 469
10 SASI_Mm02_00346918 predicted 355
11 SASI_Mm01_00079158 predicted 375
12 SASI_Mm01_00079161 predicted 301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198275
MPZL3 MISSION shRNA Bacterial Glycerol Stock
myelin protein zero-like 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-180s21c1
Sequence:CCGGGTCACTGACAAGCTTACTATACTCGAGTATAGTAAGCTTGTCAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198275.1-806s21c1
Sequence:CCGGGGACCATAGCGATGGACAATCCTCGAGGATTGTCCATCGCTATGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-283s21c1
Sequence:CCGGGCACATTTCGGGATCGGATTTCTCGAGAAATCCGATCCCGAAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-226s1c1
Sequence:CCGGGCAGCCACACAGTATCAATATCTCGAGATATTGATACTGTGTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-358s1c1
Sequence:CCGGCCATAAAGGACAATGGGACATCTCGAGATGTCCCATTGTCCTTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198275.1-734s1c1
Sequence:CCGGGAGTCACCTAAAGACAGGAAACTCGAGTTTCCTGTCTTTAGGTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-359s1c1
Sequence:CCGGCATAAAGGACAATGGGACATTCTCGAGAATGTCCCATTGTCCTTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198275.1-830s1c1
Sequence:CCGGGAGATCATCAGTAAAGACTTTCTCGAGAAAGTCTTTACTGATGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-402s21c1
Sequence:CCGGCCAGATGTGCACCATAATATTCTCGAGAATATTATGGTGCACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-64s21c1
Sequence:CCGGTGTTCTTCCAGGGTGTTTATACTCGAGTATAAACACCCTGGAAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-71s1c1
Sequence:CCGGCCAGGGTGTTTATATCGTCTTCTCGAGAAGACGATATAAACACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-328s21c1
Sequence:CCGGGGGATGCATCTATAAGTATAACTCGAGTTATACTTATAGATGCATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198275
MPZL3 MISSION shRNA shRNA Plasmid DNA
myelin protein zero-like 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-180s21c1
Sequence:CCGGGTCACTGACAAGCTTACTATACTCGAGTATAGTAAGCTTGTCAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198275.1-806s21c1
Sequence:CCGGGGACCATAGCGATGGACAATCCTCGAGGATTGTCCATCGCTATGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-283s21c1
Sequence:CCGGGCACATTTCGGGATCGGATTTCTCGAGAAATCCGATCCCGAAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-226s1c1
Sequence:CCGGGCAGCCACACAGTATCAATATCTCGAGATATTGATACTGTGTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-358s1c1
Sequence:CCGGCCATAAAGGACAATGGGACATCTCGAGATGTCCCATTGTCCTTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198275.1-734s1c1
Sequence:CCGGGAGTCACCTAAAGACAGGAAACTCGAGTTTCCTGTCTTTAGGTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-359s1c1
Sequence:CCGGCATAAAGGACAATGGGACATTCTCGAGAATGTCCCATTGTCCTTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198275.1-830s1c1
Sequence:CCGGGAGATCATCAGTAAAGACTTTCTCGAGAAAGTCTTTACTGATGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-402s21c1
Sequence:CCGGCCAGATGTGCACCATAATATTCTCGAGAATATTATGGTGCACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-64s21c1
Sequence:CCGGTGTTCTTCCAGGGTGTTTATACTCGAGTATAAACACCCTGGAAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-71s1c1
Sequence:CCGGCCAGGGTGTTTATATCGTCTTCTCGAGAAGACGATATAAACACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-328s21c1
Sequence:CCGGGGGATGCATCTATAAGTATAACTCGAGTTATACTTATAGATGCATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198275
MPZL3 MISSION shRNA Lentiviral Transduction Particles
myelin protein zero-like 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-180s21c1
Sequence:CCGGGTCACTGACAAGCTTACTATACTCGAGTATAGTAAGCTTGTCAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198275.1-806s21c1
Sequence:CCGGGGACCATAGCGATGGACAATCCTCGAGGATTGTCCATCGCTATGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-283s21c1
Sequence:CCGGGCACATTTCGGGATCGGATTTCTCGAGAAATCCGATCCCGAAATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-226s1c1
Sequence:CCGGGCAGCCACACAGTATCAATATCTCGAGATATTGATACTGTGTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-358s1c1
Sequence:CCGGCCATAAAGGACAATGGGACATCTCGAGATGTCCCATTGTCCTTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198275.1-734s1c1
Sequence:CCGGGAGTCACCTAAAGACAGGAAACTCGAGTTTCCTGTCTTTAGGTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-359s1c1
Sequence:CCGGCATAAAGGACAATGGGACATTCTCGAGAATGTCCCATTGTCCTTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198275.1-830s1c1
Sequence:CCGGGAGATCATCAGTAAAGACTTTCTCGAGAAAGTCTTTACTGATGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-402s21c1
Sequence:CCGGCCAGATGTGCACCATAATATTCTCGAGAATATTATGGTGCACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-64s21c1
Sequence:CCGGTGTTCTTCCAGGGTGTTTATACTCGAGTATAAACACCCTGGAAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198275.1-71s1c1
Sequence:CCGGCCAGGGTGTTTATATCGTCTTCTCGAGAAGACGATATAAACACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198275.1-328s21c1
Sequence:CCGGGGGATGCATCTATAAGTATAACTCGAGTTATACTTATAGATGCATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176993
VALIDATED
MPZL3 MISSION shRNA Bacterial Glycerol Stock
myelin protein zero-like 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176993.3-1614s21c1
Sequence:CCGGGTGTCATAGCCACGTATAAATCTCGAGATTTATACGTGGCTATGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176993.2-193s1c1
Sequence:CCGGGAGAGAAGATCAAGTTGAAATCTCGAGATTTCAACTTGATCTTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176993.2-1624s1c1
Sequence:CCGGCCACGTATAAATTGGATCTTTCTCGAGAAAGATCCAATTTATACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176993.2-1623s1c1
Sequence:CCGGGCCACGTATAAATTGGATCTTCTCGAGAAGATCCAATTTATACGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176993.3-345s21c1
Sequence:CCGGGATACACGCCTGTAGTCTCAGCTCGAGCTGAGACTACAGGCGTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176993.3-192s21c1
Sequence:CCGGGAGAGAAGATCAAGTTGAAATCTCGAGATTTCAACTTGATCTTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176993.3-141s21c1
Sequence:CCGGTCGTCCTCTCCTTGGAGATAACTCGAGTTATCTCCAAGGAGAGGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176993.3-248s21c1
Sequence:CCGGCTGACCATAGACTGGACATACCTCGAGGTATGTCCAGTCTATGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176993
VALIDATED
MPZL3 MISSION shRNA shRNA Plasmid DNA
myelin protein zero-like 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176993.3-1614s21c1
Sequence:CCGGGTGTCATAGCCACGTATAAATCTCGAGATTTATACGTGGCTATGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176993.2-193s1c1
Sequence:CCGGGAGAGAAGATCAAGTTGAAATCTCGAGATTTCAACTTGATCTTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176993.2-1624s1c1
Sequence:CCGGCCACGTATAAATTGGATCTTTCTCGAGAAAGATCCAATTTATACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176993.2-1623s1c1
Sequence:CCGGGCCACGTATAAATTGGATCTTCTCGAGAAGATCCAATTTATACGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176993.3-345s21c1
Sequence:CCGGGATACACGCCTGTAGTCTCAGCTCGAGCTGAGACTACAGGCGTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176993.3-192s21c1
Sequence:CCGGGAGAGAAGATCAAGTTGAAATCTCGAGATTTCAACTTGATCTTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176993.3-141s21c1
Sequence:CCGGTCGTCCTCTCCTTGGAGATAACTCGAGTTATCTCCAAGGAGAGGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176993.3-248s21c1
Sequence:CCGGCTGACCATAGACTGGACATACCTCGAGGTATGTCCAGTCTATGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176993
VALIDATED
MPZL3 MISSION shRNA Lentiviral Transduction Particles
myelin protein zero-like 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176993.3-1614s21c1
Sequence:CCGGGTGTCATAGCCACGTATAAATCTCGAGATTTATACGTGGCTATGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176993.2-193s1c1
Sequence:CCGGGAGAGAAGATCAAGTTGAAATCTCGAGATTTCAACTTGATCTTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176993.2-1624s1c1
Sequence:CCGGCCACGTATAAATTGGATCTTTCTCGAGAAAGATCCAATTTATACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176993.2-1623s1c1
Sequence:CCGGGCCACGTATAAATTGGATCTTCTCGAGAAGATCCAATTTATACGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176993.3-345s21c1
Sequence:CCGGGATACACGCCTGTAGTCTCAGCTCGAGCTGAGACTACAGGCGTGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176993.3-192s21c1
Sequence:CCGGGAGAGAAGATCAAGTTGAAATCTCGAGATTTCAACTTGATCTTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176993.3-141s21c1
Sequence:CCGGTCGTCCTCTCCTTGGAGATAACTCGAGTTATCTCCAAGGAGAGGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176993.3-248s21c1
Sequence:CCGGCTGACCATAGACTGGACATACCTCGAGGTATGTCCAGTCTATGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)