EMAIL THIS PAGE TO A FRIEND

MR1

major histocompatibility complex, class I-related

56 Gene Product Result for
Synonyms: HLALS
Gene ID:
Mouse(15064) major histocompatibility complex, class I-related
Rat(25119) major histocompatibility complex, class I-related
chicken(427746) major histocompatibility complex, class I-related MR1
dog(100686784) major histocompatibility complex, class I-related
cow(506206) major histocompatibility complex, class I-related
sheep(101102078) major histocompatibility complex, class I-related
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008209 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008209 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008209 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013811 MISSION® esiRNA esiRNA targeting mouse Mr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001531 Rosetta Predictions human pricing
XM_001072150 Rosetta Predictions rat pricing
XM_213919 Rosetta Predictions rat pricing
NM_008209 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332066 predicted 897
2 SASI_Hs01_00174562 predicted 735
3 SASI_Hs01_00174563 predicted 889
4 SASI_Hs01_00174564 predicted 504
5 SASI_Hs01_00174566 predicted 220
6 SASI_Hs01_00174567 predicted 660
7 SASI_Hs01_00174568 predicted 232
8 SASI_Hs01_00174569 predicted 1009
9 SASI_Hs01_00174570 predicted 496
10 SASI_Hs02_00332067 predicted 653
11 SASI_Hs01_00174565 predicted 1000
12 SASI_Hs01_00174571 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337998 predicted 558
2 SASI_Rn02_00337999 predicted 922
3 SASI_Rn02_00338000 predicted 1039
4 SASI_Rn02_00338001 predicted 617
5 SASI_Rn02_00338002 predicted 414
6 SASI_Rn02_00338003 predicted 580
7 SASI_Rn02_00338004 predicted 896
8 SASI_Rn02_00338005 predicted 1085
9 SASI_Rn02_00338006 predicted 696
10 SASI_Rn02_00338007 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375006 predicted 562
2 SASI_Rn02_00375007 predicted 640
3 SASI_Rn02_00375008 predicted 218
4 SASI_Rn02_00375009 predicted 515
5 SASI_Rn02_00375010 predicted 544
6 SASI_Rn02_00375011 predicted 565
7 SASI_Rn02_00375012 predicted 620
8 SASI_Rn02_00375013 predicted 250
9 SASI_Rn02_00375014 predicted 414
10 SASI_Rn02_00375015 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197161 predicted 687
2 SASI_Mm01_00197162 predicted 638
3 SASI_Mm01_00197163 predicted 856
4 SASI_Mm01_00197164 predicted 1106
5 SASI_Mm01_00197165 predicted 1200
6 SASI_Mm01_00197166 predicted 889
7 SASI_Mm01_00197167 predicted 640
8 SASI_Mm01_00197168 predicted 477
9 SASI_Mm02_00313377 predicted 648
10 SASI_Mm01_00197169 predicted 582
11 SASI_Mm01_00197160 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001531
VALIDATED
MR1 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class I-related
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-159s21c1
Sequence:CCGGTCGCACCCTATCACCACATATCTCGAGATATGTGGTGATAGGGTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-783s21c1
Sequence:CCGGTATCAGGCGTGGGCATCAATTCTCGAGAATTGATGCCCACGCCTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-1014s21c1
Sequence:CCGGCCAACACCAGATCGATGATTGCTCGAGCAATCATCGATCTGGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001531.1-622s1c1
Sequence:CCGGTCAGAGTAAATCGCAAAGAAACTCGAGTTTCTTTGCGATTTACTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001531.1-510s1c1
Sequence:CCGGCAGCATGAGTTGCTGTATCAACTCGAGTTGATACAGCAACTCATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-71s1c1
Sequence:CCGGCCGGACGCACTCTCTGAGATACTCGAGTATCTCAGAGAGTGCGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-885s1c1
Sequence:CCGGGAATCAGAAACTATCCCTCTTCTCGAGAAGAGGGATAGTTTCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-335s1c1
Sequence:CCGGGTCTCACACTTACCAGAGAATCTCGAGATTCTCTGGTAAGTGTGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001531
VALIDATED
MR1 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class I-related
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-159s21c1
Sequence:CCGGTCGCACCCTATCACCACATATCTCGAGATATGTGGTGATAGGGTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-783s21c1
Sequence:CCGGTATCAGGCGTGGGCATCAATTCTCGAGAATTGATGCCCACGCCTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-1014s21c1
Sequence:CCGGCCAACACCAGATCGATGATTGCTCGAGCAATCATCGATCTGGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001531.1-622s1c1
Sequence:CCGGTCAGAGTAAATCGCAAAGAAACTCGAGTTTCTTTGCGATTTACTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001531.1-510s1c1
Sequence:CCGGCAGCATGAGTTGCTGTATCAACTCGAGTTGATACAGCAACTCATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-71s1c1
Sequence:CCGGCCGGACGCACTCTCTGAGATACTCGAGTATCTCAGAGAGTGCGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-885s1c1
Sequence:CCGGGAATCAGAAACTATCCCTCTTCTCGAGAAGAGGGATAGTTTCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-335s1c1
Sequence:CCGGGTCTCACACTTACCAGAGAATCTCGAGATTCTCTGGTAAGTGTGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001531
VALIDATED
MR1 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class I-related
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-159s21c1
Sequence:CCGGTCGCACCCTATCACCACATATCTCGAGATATGTGGTGATAGGGTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-783s21c1
Sequence:CCGGTATCAGGCGTGGGCATCAATTCTCGAGAATTGATGCCCACGCCTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001531.1-1014s21c1
Sequence:CCGGCCAACACCAGATCGATGATTGCTCGAGCAATCATCGATCTGGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001531.1-622s1c1
Sequence:CCGGTCAGAGTAAATCGCAAAGAAACTCGAGTTTCTTTGCGATTTACTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001531.1-510s1c1
Sequence:CCGGCAGCATGAGTTGCTGTATCAACTCGAGTTGATACAGCAACTCATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-71s1c1
Sequence:CCGGCCGGACGCACTCTCTGAGATACTCGAGTATCTCAGAGAGTGCGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-885s1c1
Sequence:CCGGGAATCAGAAACTATCCCTCTTCTCGAGAAGAGGGATAGTTTCTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001531.1-335s1c1
Sequence:CCGGGTCTCACACTTACCAGAGAATCTCGAGATTCTCTGGTAAGTGTGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008209
VALIDATED
MR1 MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class I-related
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-412s21c1
Sequence:CCGGGCTTCACACCTACCAGAGAATCTCGAGATTCTCTGGTAGGTGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008209.4-2431s21c1
Sequence:CCGGCCACCACTAATAACAAACAAACTCGAGTTTGTTTGTTATTAGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-203s21c1
Sequence:CCGGGTCCCTGAATTTATCTCTGTTCTCGAGAACAGAGATAAATTCAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-890s21c1
Sequence:CCGGCCTCAGAGCAATGATGTTTATCTCGAGATAAACATCATTGCTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-918s1c1
Sequence:CCGGCCTCAGAGCAATGATGTTTATCTCGAGATAAACATCATTGCTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008209.2-721s1c1
Sequence:CCGGCAGTGGTAAGAACAACTCGAACTCGAGTTCGAGTTGTTCTTACCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-231s1c1
Sequence:CCGGGTCCCTGAATTTATCTCTGTTCTCGAGAACAGAGATAAATTCAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008209.2-2459s1c1
Sequence:CCGGCCACCACTAATAACAAACAAACTCGAGTTTGTTTGTTATTAGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-440s1c1
Sequence:CCGGGCTTCACACCTACCAGAGAATCTCGAGATTCTCTGGTAGGTGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008209
VALIDATED
MR1 MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class I-related
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-412s21c1
Sequence:CCGGGCTTCACACCTACCAGAGAATCTCGAGATTCTCTGGTAGGTGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008209.4-2431s21c1
Sequence:CCGGCCACCACTAATAACAAACAAACTCGAGTTTGTTTGTTATTAGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-203s21c1
Sequence:CCGGGTCCCTGAATTTATCTCTGTTCTCGAGAACAGAGATAAATTCAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-890s21c1
Sequence:CCGGCCTCAGAGCAATGATGTTTATCTCGAGATAAACATCATTGCTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-918s1c1
Sequence:CCGGCCTCAGAGCAATGATGTTTATCTCGAGATAAACATCATTGCTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008209.2-721s1c1
Sequence:CCGGCAGTGGTAAGAACAACTCGAACTCGAGTTCGAGTTGTTCTTACCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-231s1c1
Sequence:CCGGGTCCCTGAATTTATCTCTGTTCTCGAGAACAGAGATAAATTCAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008209.2-2459s1c1
Sequence:CCGGCCACCACTAATAACAAACAAACTCGAGTTTGTTTGTTATTAGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-440s1c1
Sequence:CCGGGCTTCACACCTACCAGAGAATCTCGAGATTCTCTGGTAGGTGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008209
VALIDATED
MR1 MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class I-related
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-412s21c1
Sequence:CCGGGCTTCACACCTACCAGAGAATCTCGAGATTCTCTGGTAGGTGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008209.4-2431s21c1
Sequence:CCGGCCACCACTAATAACAAACAAACTCGAGTTTGTTTGTTATTAGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-203s21c1
Sequence:CCGGGTCCCTGAATTTATCTCTGTTCTCGAGAACAGAGATAAATTCAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008209.4-890s21c1
Sequence:CCGGCCTCAGAGCAATGATGTTTATCTCGAGATAAACATCATTGCTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-918s1c1
Sequence:CCGGCCTCAGAGCAATGATGTTTATCTCGAGATAAACATCATTGCTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008209.2-721s1c1
Sequence:CCGGCAGTGGTAAGAACAACTCGAACTCGAGTTCGAGTTGTTCTTACCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-231s1c1
Sequence:CCGGGTCCCTGAATTTATCTCTGTTCTCGAGAACAGAGATAAATTCAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008209.2-2459s1c1
Sequence:CCGGCCACCACTAATAACAAACAAACTCGAGTTTGTTTGTTATTAGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008209.2-440s1c1
Sequence:CCGGGCTTCACACCTACCAGAGAATCTCGAGATTCTCTGGTAGGTGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)