EMAIL THIS PAGE TO A FRIEND

MRAP2

melanocortin 2 receptor accessory protein 2

127 Gene Product Result for
Synonyms: C6orf117 RP11-51G5.2 bA51G5.2
UniProtKB ID: Q96G30, A8K9M1, Q8IXM9, Q8N2D1
Gene ID:
Mouse(244958) melanocortin 2 receptor accessory protein 2
Rat(363112) melanocortin 2 receptor accessory protein 2
chicken(421836) melanocortin 2 receptor accessory protein 2
cow(781188) melanocortin 2 receptor accessory protein 2
domestic cat(101083426) melanocortin 2 receptor accessory protein 2
dog(611524) melanocortin 2 receptor accessory protein 2
naked mole-rat(101711365) melanocortin 2 receptor accessory protein 2
domestic guinea pig(100727797) melanocortin 2 receptor accessory protein 2
sheep(101117592) melanocortin 2 receptor accessory protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138409 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048721 MISSION® esiRNA esiRNA human MRAP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138409 Rosetta Predictions human pricing
NM_001108774 Rosetta Predictions rat pricing
XM_343445 Rosetta Predictions rat pricing
XM_147017 Rosetta Predictions mouse pricing
XM_918215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246626 predicted 337
2 SASI_Hs01_00246628 predicted 345
3 SASI_Hs01_00246627 predicted 437
4 SASI_Hs01_00246629 predicted 459
5 SASI_Hs01_00246630 predicted 402
6 SASI_Hs01_00246631 predicted 650
7 SASI_Hs01_00246632 predicted 659
8 SASI_Hs01_00246633 predicted 453
9 SASI_Hs01_00246634 predicted 474
10 SASI_Hs01_00246635 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241945 predicted 571
2 SASI_Rn02_00241946 predicted 425
3 SASI_Rn02_00241947 predicted 652
4 SASI_Rn02_00241948 predicted 397
5 SASI_Rn02_00241949 predicted 232
6 SASI_Rn02_00241950 predicted 590
7 SASI_Rn02_00241951 predicted 292
8 SASI_Rn02_00241952 predicted 551
9 SASI_Rn02_00241953 predicted 440
10 SASI_Rn02_00241954 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194398 predicted 575
2 SASI_Rn01_00194399 predicted 434
3 SASI_Rn01_00194400 predicted 656
4 SASI_Rn01_00194401 predicted 258
5 SASI_Rn01_00194402 predicted 402
6 SASI_Rn01_00194403 predicted 234
7 SASI_Rn01_00194404 predicted 595
8 SASI_Rn01_00194405 predicted 302
9 SASI_Rn01_00194406 predicted 563
10 SASI_Rn01_00194407 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_147017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256946 predicted 225
2 SASI_Mm01_00256947 predicted 207
3 SASI_Mm01_00256948 predicted 205
4 SASI_Mm01_00256949 predicted 230
5 SASI_Mm01_00256950 predicted 315
6 SASI_Mm01_00256951 predicted 244
7 SASI_Mm02_00425348 predicted 282
8 SASI_Mm01_00256952 predicted 204
9 SASI_Mm01_00256953 predicted 202
10 SASI_Mm01_00256954 predicted 216
11 SASI_Mm01_00256955 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_918215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441734 predicted 448
2 SASI_Mm02_00441735 predicted 213
3 SASI_Mm02_00441736 predicted 342
4 SASI_Mm02_00441737 predicted 226
5 SASI_Mm02_00441738 predicted 312
6 SASI_Mm02_00441739 predicted 346
7 SASI_Mm02_00441740 predicted 239
8 SASI_Mm02_00441741 predicted 202
9 SASI_Mm02_00441742 predicted 467
10 SASI_Mm02_00441743 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101482
MRAP2 MISSION shRNA Bacterial Glycerol Stock
melanocortin 2 receptor accessory protein 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101482.1-1021s21c1
Sequence:CCGGGAAACAATTAGCCACATATATCTCGAGATATATGTGGCTAATTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-206s21c1
Sequence:CCGGGAAGGACTGAAGGCTCATAAACTCGAGTTTATGAGCCTTCAGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-165s21c1
Sequence:CCGGCCTGGGAATACGAGTACTATGCTCGAGCATAGTACTCGTATTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-437s21c1
Sequence:CCGGAGGTCTCTGTTCCACTGTTACCTCGAGGTAACAGTGGAACAGAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101482
MRAP2 MISSION shRNA shRNA Plasmid DNA
melanocortin 2 receptor accessory protein 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101482.1-1021s21c1
Sequence:CCGGGAAACAATTAGCCACATATATCTCGAGATATATGTGGCTAATTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-206s21c1
Sequence:CCGGGAAGGACTGAAGGCTCATAAACTCGAGTTTATGAGCCTTCAGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-165s21c1
Sequence:CCGGCCTGGGAATACGAGTACTATGCTCGAGCATAGTACTCGTATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-437s21c1
Sequence:CCGGAGGTCTCTGTTCCACTGTTACCTCGAGGTAACAGTGGAACAGAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101482
MRAP2 MISSION shRNA Lentiviral Transduction Particles
melanocortin 2 receptor accessory protein 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101482.1-1021s21c1
Sequence:CCGGGAAACAATTAGCCACATATATCTCGAGATATATGTGGCTAATTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-206s21c1
Sequence:CCGGGAAGGACTGAAGGCTCATAAACTCGAGTTTATGAGCCTTCAGTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-165s21c1
Sequence:CCGGCCTGGGAATACGAGTACTATGCTCGAGCATAGTACTCGTATTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101482.1-437s21c1
Sequence:CCGGAGGTCTCTGTTCCACTGTTACCTCGAGGTAACAGTGGAACAGAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138409
VALIDATED
MRAP2 MISSION shRNA Bacterial Glycerol Stock
melanocortin 2 receptor accessory protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-694s1c1
Sequence:CCGGCTTTGTGAACACAGACCAGAACTCGAGTTCTGGTCTGTGTTCACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138409.1-456s1c1
Sequence:CCGGGCTTTGTGTCAGACTTTGGAACTCGAGTTCCAAAGTCTGACACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-429s1c1
Sequence:CCGGCCTCAGAGAAGAGATTCAGAACTCGAGTTCTGAATCTCTTCTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-482s1c1
Sequence:CCGGCTGGAGCCAGATAAAGTATTTCTCGAGAAATACTTTATCTGGCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138409.1-1629s1c1
Sequence:CCGGCCAGAATGTCAGGAGACTCATCTCGAGATGAGTCTCCTGACATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-737s1c1
Sequence:CCGGCTGATTTCTGAACCACCTATTCTCGAGAATAGGTGGTTCAGAAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138409
VALIDATED
MRAP2 MISSION shRNA shRNA Plasmid DNA
melanocortin 2 receptor accessory protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-694s1c1
Sequence:CCGGCTTTGTGAACACAGACCAGAACTCGAGTTCTGGTCTGTGTTCACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138409.1-456s1c1
Sequence:CCGGGCTTTGTGTCAGACTTTGGAACTCGAGTTCCAAAGTCTGACACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-429s1c1
Sequence:CCGGCCTCAGAGAAGAGATTCAGAACTCGAGTTCTGAATCTCTTCTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-482s1c1
Sequence:CCGGCTGGAGCCAGATAAAGTATTTCTCGAGAAATACTTTATCTGGCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138409.1-1629s1c1
Sequence:CCGGCCAGAATGTCAGGAGACTCATCTCGAGATGAGTCTCCTGACATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-737s1c1
Sequence:CCGGCTGATTTCTGAACCACCTATTCTCGAGAATAGGTGGTTCAGAAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138409
VALIDATED
MRAP2 MISSION shRNA Lentiviral Transduction Particles
melanocortin 2 receptor accessory protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-694s1c1
Sequence:CCGGCTTTGTGAACACAGACCAGAACTCGAGTTCTGGTCTGTGTTCACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138409.1-456s1c1
Sequence:CCGGGCTTTGTGTCAGACTTTGGAACTCGAGTTCCAAAGTCTGACACAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-429s1c1
Sequence:CCGGCCTCAGAGAAGAGATTCAGAACTCGAGTTCTGAATCTCTTCTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-482s1c1
Sequence:CCGGCTGGAGCCAGATAAAGTATTTCTCGAGAAATACTTTATCTGGCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138409.1-1629s1c1
Sequence:CCGGCCAGAATGTCAGGAGACTCATCTCGAGATGAGTCTCCTGACATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138409.1-737s1c1
Sequence:CCGGCTGATTTCTGAACCACCTATTCTCGAGAATAGGTGGTTCAGAAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)