EMAIL THIS PAGE TO A FRIEND

MRC1

mannose receptor, C type 1

99 Gene Product Result for
Synonyms: CD206 CLEC13D CLEC13DL MMR MRC1L1 bA541I19.1
UniProtKB ID: P22897, A5PKW3, Q5VSJ2, Q5VSK2
Gene ID:
Human(4360) Summary: The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Apr 2011]
Mouse(17533) mannose receptor, C type 1
Rat(291327) mannose receptor, C type 1
dog(487114) mannose receptor, C type 1
domestic cat(101092193) mannose receptor, C type 1
Horse(100068247) mannose receptor, C type 1
cow(787578) mannose receptor, C type 1
naked mole-rat(101717030) mannose receptor, C type 1
Domestic Rabbit(100345866) mannose receptor, C type 1
domestic guinea pig(100720301) mannose receptor, C type 1
sheep(100505388) mannose receptor, C type 1
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002438 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002438 Rosetta Predictions human pricing
NM_001106123 Rosetta Predictions rat pricing
NM_008625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215457 predicted 2318
2 SASI_Hs01_00215458 predicted 3038
3 SASI_Hs01_00215459 predicted 479
4 SASI_Hs01_00215460 predicted 2179
5 SASI_Hs01_00215461 predicted 290
6 SASI_Hs01_00215462 predicted 1353
7 SASI_Hs02_00333838 predicted 2113
8 SASI_Hs02_00333839 predicted 3589
9 SASI_Hs01_00215463 predicted 3303
10 SASI_Hs01_00215465 predicted 987
11 SASI_Hs01_00215464 predicted 2335
12 SASI_Hs01_00215466 predicted 4355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215848 predicted 3945
2 SASI_Rn02_00215849 predicted 3655
3 SASI_Rn02_00215850 predicted 2313
4 SASI_Rn02_00215851 predicted 1130
5 SASI_Rn02_00215852 predicted 1262
6 SASI_Rn02_00215853 predicted 3746
7 SASI_Rn02_00215854 predicted 2192
8 SASI_Rn02_00215855 predicted 689
9 SASI_Rn02_00215856 predicted 4009
10 SASI_Rn02_00215857 predicted 3670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061795 predicted 562
2 SASI_Mm01_00061796 predicted 4072
3 SASI_Mm02_00314324 predicted 3206
4 SASI_Mm01_00061797 predicted 1544
5 SASI_Mm01_00061798 predicted 2516
6 SASI_Mm01_00061799 predicted 217
7 SASI_Mm01_00061800 predicted 1242
8 SASI_Mm01_00061802 predicted 1125
9 SASI_Mm01_00061803 predicted 3447
10 SASI_Mm01_00061804 predicted 291
11 SASI_Mm01_00061801 predicted 1320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008625
MRC1 MISSION shRNA Bacterial Glycerol Stock
mannose receptor, C type 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-4070s1c1
Sequence:CCGGCCTCTGGTGAACGGAATGATTCTCGAGAATCATTCCGTTCACCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-1351s1c1
Sequence:CCGGCCAAATGATGAGCTGTGGATTCTCGAGAATCCACAGCTCATCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-2687s1c1
Sequence:CCGGGCATGTTAATCAGCATGGATACTCGAGTATCCATGCTGATTAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-3534s1c1
Sequence:CCGGGCACCCATTTAATGTACCCATCTCGAGATGGGTACATTAAATGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-251s1c1
Sequence:CCGGCGGAAGCTGAATCCCAGAAATCTCGAGATTTCTGGGATTCAGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008625
MRC1 MISSION shRNA shRNA Plasmid DNA
mannose receptor, C type 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-4070s1c1
Sequence:CCGGCCTCTGGTGAACGGAATGATTCTCGAGAATCATTCCGTTCACCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-1351s1c1
Sequence:CCGGCCAAATGATGAGCTGTGGATTCTCGAGAATCCACAGCTCATCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-2687s1c1
Sequence:CCGGGCATGTTAATCAGCATGGATACTCGAGTATCCATGCTGATTAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-3534s1c1
Sequence:CCGGGCACCCATTTAATGTACCCATCTCGAGATGGGTACATTAAATGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-251s1c1
Sequence:CCGGCGGAAGCTGAATCCCAGAAATCTCGAGATTTCTGGGATTCAGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008625
MRC1 MISSION shRNA Lentiviral Transduction Particles
mannose receptor, C type 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-4070s1c1
Sequence:CCGGCCTCTGGTGAACGGAATGATTCTCGAGAATCATTCCGTTCACCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-1351s1c1
Sequence:CCGGCCAAATGATGAGCTGTGGATTCTCGAGAATCCACAGCTCATCATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-2687s1c1
Sequence:CCGGGCATGTTAATCAGCATGGATACTCGAGTATCCATGCTGATTAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-3534s1c1
Sequence:CCGGGCACCCATTTAATGTACCCATCTCGAGATGGGTACATTAAATGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008625.1-251s1c1
Sequence:CCGGCGGAAGCTGAATCCCAGAAATCTCGAGATTTCTGGGATTCAGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002438
MRC1 MISSION shRNA Bacterial Glycerol Stock
mannose receptor, C type 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-2869s1c1
Sequence:CCGGCCAGCGACATAACAGTAGTATCTCGAGATACTACTGTTATGTCGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-985s1c1
Sequence:CCGGCCGCAGTCCTTTCCGATATTTCTCGAGAAATATCGGAAAGGACTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-1161s1c1
Sequence:CCGGCCTCAGAAAGTGATGTGCCTACTCGAGTAGGCACATCACTTTCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-3668s1c1
Sequence:CCGGGCATGTGTTTATCTGGATCTTCTCGAGAAGATCCAGATAAACACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-4243s1c1
Sequence:CCGGCCCTTCTAAACCGTCTTCCAACTCGAGTTGGAAGACGGTTTAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002438
MRC1 MISSION shRNA shRNA Plasmid DNA
mannose receptor, C type 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-2869s1c1
Sequence:CCGGCCAGCGACATAACAGTAGTATCTCGAGATACTACTGTTATGTCGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-985s1c1
Sequence:CCGGCCGCAGTCCTTTCCGATATTTCTCGAGAAATATCGGAAAGGACTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-1161s1c1
Sequence:CCGGCCTCAGAAAGTGATGTGCCTACTCGAGTAGGCACATCACTTTCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-3668s1c1
Sequence:CCGGGCATGTGTTTATCTGGATCTTCTCGAGAAGATCCAGATAAACACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-4243s1c1
Sequence:CCGGCCCTTCTAAACCGTCTTCCAACTCGAGTTGGAAGACGGTTTAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002438
MRC1 MISSION shRNA Lentiviral Transduction Particles
mannose receptor, C type 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-2869s1c1
Sequence:CCGGCCAGCGACATAACAGTAGTATCTCGAGATACTACTGTTATGTCGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-985s1c1
Sequence:CCGGCCGCAGTCCTTTCCGATATTTCTCGAGAAATATCGGAAAGGACTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-1161s1c1
Sequence:CCGGCCTCAGAAAGTGATGTGCCTACTCGAGTAGGCACATCACTTTCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-3668s1c1
Sequence:CCGGGCATGTGTTTATCTGGATCTTCTCGAGAAGATCCAGATAAACACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002438.1-4243s1c1
Sequence:CCGGCCCTTCTAAACCGTCTTCCAACTCGAGTTGGAAGACGGTTTAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)