EMAIL THIS PAGE TO A FRIEND

MRC2

mannose receptor, C type 2

102 Gene Product Result for
Synonyms: CD280 CLEC13E ENDO180 UPARAP
UniProtKB ID: Q9UBG0, A6H8K4, D3DU08, Q7LGE7, Q9Y5P9
Gene ID:
Human(9902) Summary: This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
Mouse(17534) mannose receptor, C type 2
Rat(498011) mannose receptor, C type 2
Zebrafish(100004793) mannose receptor, C type 2
cow(529049) mannose receptor, C type 2
domestic cat(101082106) mannose receptor, C type 2
dog(100688560) mannose receptor, C type 2
chicken(419950) mannose receptor, C type 2
sheep(101122041) mannose receptor, C type 2
domestic guinea pig(100733022) mannose receptor, C type 2
naked mole-rat(101698734) mannose receptor, C type 2
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503729 Anti-MRC2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA041991 Anti-MRC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0927 AQUA Peptide TLGDQLSLLLGA[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006039 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006039 Rosetta Predictions human pricing
NM_001024687 Rosetta Predictions rat pricing
NM_008626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130342 predicted 1733
2 SASI_Hs02_00340783 predicted 4810
3 SASI_Hs01_00130343 predicted 2586
4 SASI_Hs01_00130344 predicted 2569
5 SASI_Hs01_00130345 predicted 4732
6 SASI_Hs01_00130347 predicted 4489
7 SASI_Hs01_00130348 predicted 2582
8 SASI_Hs02_00340784 predicted 2430
9 SASI_Hs01_00130349 predicted 727
10 SASI_Hs01_00130350 predicted 2435
11 SASI_Hs01_00130341 predicted 385
12 SASI_Hs01_00130346 predicted 3954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052194 predicted 739
2 SASI_Rn01_00052195 predicted 3976
3 SASI_Rn01_00052196 predicted 2823
4 SASI_Rn01_00052197 predicted 2179
5 SASI_Rn01_00052198 predicted 2929
6 SASI_Rn01_00052199 predicted 518
7 SASI_Rn01_00052200 predicted 1328
8 SASI_Rn01_00052201 predicted 736
9 SASI_Rn01_00052203 predicted 1118
10 SASI_Rn02_00202609 predicted 3891
11 SASI_Rn01_00052202 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100458 predicted 884
2 SASI_Mm02_00314325 predicted 441
3 SASI_Mm01_00100459 predicted 654
4 SASI_Mm01_00100460 predicted 4329
5 SASI_Mm02_00314326 predicted 1929
6 SASI_Mm01_00100463 predicted 3959
7 SASI_Mm01_00100464 predicted 632
8 SASI_Mm01_00100466 predicted 1844
9 SASI_Mm01_00100467 predicted 643
10 SASI_Mm02_00314327 predicted 2905
11 SASI_Mm01_00100461 predicted 2283
12 SASI_Mm01_00100462 predicted 840
13 SASI_Mm01_00100465 predicted 2812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008626
VALIDATED
MRC2 MISSION shRNA Bacterial Glycerol Stock
mannose receptor, C type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008626.1-1177s1c1
Sequence:CCGGGCAAGAAGAAACCCAACGCTACTCGAGTAGCGTTGGGTTTCTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-221s1c1
Sequence:CCGGGCCTGATGTCTTCCTCATCTTCTCGAGAAGATGAGGAAGACATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-2425s1c1
Sequence:CCGGGCCGACATGATGACGATGATACTCGAGTATCATCGTCATCATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008626.1-2804s1c1
Sequence:CCGGGTGGACAGATGGTTCTATTATCTCGAGATAATAGAACCATCTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-3032s1c1
Sequence:CCGGCCAGTTCCTCAATAAGTGTTTCTCGAGAAACACTTATTGAGGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008626
VALIDATED
MRC2 MISSION shRNA shRNA Plasmid DNA
mannose receptor, C type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008626.1-1177s1c1
Sequence:CCGGGCAAGAAGAAACCCAACGCTACTCGAGTAGCGTTGGGTTTCTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-221s1c1
Sequence:CCGGGCCTGATGTCTTCCTCATCTTCTCGAGAAGATGAGGAAGACATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-2425s1c1
Sequence:CCGGGCCGACATGATGACGATGATACTCGAGTATCATCGTCATCATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008626.1-2804s1c1
Sequence:CCGGGTGGACAGATGGTTCTATTATCTCGAGATAATAGAACCATCTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-3032s1c1
Sequence:CCGGCCAGTTCCTCAATAAGTGTTTCTCGAGAAACACTTATTGAGGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008626
VALIDATED
MRC2 MISSION shRNA Lentiviral Transduction Particles
mannose receptor, C type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008626.1-1177s1c1
Sequence:CCGGGCAAGAAGAAACCCAACGCTACTCGAGTAGCGTTGGGTTTCTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-221s1c1
Sequence:CCGGGCCTGATGTCTTCCTCATCTTCTCGAGAAGATGAGGAAGACATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-2425s1c1
Sequence:CCGGGCCGACATGATGACGATGATACTCGAGTATCATCGTCATCATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008626.1-2804s1c1
Sequence:CCGGGTGGACAGATGGTTCTATTATCTCGAGATAATAGAACCATCTGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008626.1-3032s1c1
Sequence:CCGGCCAGTTCCTCAATAAGTGTTTCTCGAGAAACACTTATTGAGGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006039
VALIDATED
MRC2 MISSION shRNA Bacterial Glycerol Stock
mannose receptor, C type 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006039.2-2080s1c1
Sequence:CCGGCCGGTATTGCTATAAGGTGTTCTCGAGAACACCTTATAGCAATACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-1240s21c1
Sequence:CCGGCACGAGCAGACCTACATCAACCTCGAGGTTGATGTAGGTCTGCTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006039.2-4460s1c1
Sequence:CCGGGAAATGAATGAGCAGCAAGAACTCGAGTTCTTGCTGCTCATTCATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-577s1c1
Sequence:CCGGCCAGGGAAACTCCCACGGAAACTCGAGTTTCCGTGGGAGTTTCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-390s1c1
Sequence:CCGGCACTGAATCTTCGCTGGCATTCTCGAGAATGCCAGCGAAGATTCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-3125s1c1
Sequence:CCGGCCCAATGTGACCTTTGACCTTCTCGAGAAGGTCAAAGGTCACATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-1724s21c1
Sequence:CCGGGGATCGGCCTCAACGATTTGACTCGAGTCAAATCGTTGAGGCCGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-2698s21c1
Sequence:CCGGGGGTTCTCTTACCACAATTTCCTCGAGGAAATTGTGGTAAGAGAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-2583s21c1
Sequence:CCGGCAACAAGATCTTCGGTGAATCCTCGAGGATTCACCGAAGATCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006039
VALIDATED
MRC2 MISSION shRNA shRNA Plasmid DNA
mannose receptor, C type 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006039.2-2080s1c1
Sequence:CCGGCCGGTATTGCTATAAGGTGTTCTCGAGAACACCTTATAGCAATACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-1240s21c1
Sequence:CCGGCACGAGCAGACCTACATCAACCTCGAGGTTGATGTAGGTCTGCTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006039.2-4460s1c1
Sequence:CCGGGAAATGAATGAGCAGCAAGAACTCGAGTTCTTGCTGCTCATTCATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-577s1c1
Sequence:CCGGCCAGGGAAACTCCCACGGAAACTCGAGTTTCCGTGGGAGTTTCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-390s1c1
Sequence:CCGGCACTGAATCTTCGCTGGCATTCTCGAGAATGCCAGCGAAGATTCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-3125s1c1
Sequence:CCGGCCCAATGTGACCTTTGACCTTCTCGAGAAGGTCAAAGGTCACATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-1724s21c1
Sequence:CCGGGGATCGGCCTCAACGATTTGACTCGAGTCAAATCGTTGAGGCCGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-2698s21c1
Sequence:CCGGGGGTTCTCTTACCACAATTTCCTCGAGGAAATTGTGGTAAGAGAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-2583s21c1
Sequence:CCGGCAACAAGATCTTCGGTGAATCCTCGAGGATTCACCGAAGATCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006039
VALIDATED
MRC2 MISSION shRNA Lentiviral Transduction Particles
mannose receptor, C type 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006039.2-2080s1c1
Sequence:CCGGCCGGTATTGCTATAAGGTGTTCTCGAGAACACCTTATAGCAATACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-1240s21c1
Sequence:CCGGCACGAGCAGACCTACATCAACCTCGAGGTTGATGTAGGTCTGCTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006039.2-4460s1c1
Sequence:CCGGGAAATGAATGAGCAGCAAGAACTCGAGTTCTTGCTGCTCATTCATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-577s1c1
Sequence:CCGGCCAGGGAAACTCCCACGGAAACTCGAGTTTCCGTGGGAGTTTCCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-390s1c1
Sequence:CCGGCACTGAATCTTCGCTGGCATTCTCGAGAATGCCAGCGAAGATTCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006039.2-3125s1c1
Sequence:CCGGCCCAATGTGACCTTTGACCTTCTCGAGAAGGTCAAAGGTCACATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-1724s21c1
Sequence:CCGGGGATCGGCCTCAACGATTTGACTCGAGTCAAATCGTTGAGGCCGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-2698s21c1
Sequence:CCGGGGGTTCTCTTACCACAATTTCCTCGAGGAAATTGTGGTAAGAGAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006039.3-2583s21c1
Sequence:CCGGCAACAAGATCTTCGGTGAATCCTCGAGGATTCACCGAAGATCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)