EMAIL THIS PAGE TO A FRIEND

MRE11A

MRE11 meiotic recombination 11 homolog A (S. cerevisiae)

75 Gene Product Result for
Synonyms: ATLD HNGS1 MRE11 MRE11B
UniProtKB ID: P49959, O43475
Gene ID:
Human(4361) Summary: This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(17535) meiotic recombination 11 homolog A (S. cerevisiae)
Rat(64046) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Zebrafish(406637) meiotic recombination 11 homolog A (S. cerevisiae)
Horse(100060936) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
domestic cat(101086923) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
dog(494006) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
chicken(395555) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
sheep(101114806) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
naked mole-rat(101709211) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Domestic Rabbit(100356946) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
domestic guinea pig(100721147) MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M9948 Mirin ≥98% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005591 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005590 Rosetta Predictions human pricing
NM_005591 Rosetta Predictions human pricing
NM_022279 Rosetta Predictions rat pricing
NM_018736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339885 predicted 1084
2 SASI_Hs01_00055402 predicted 1733
3 SASI_Hs01_00055403 predicted 908
4 SASI_Hs01_00055405 predicted 1283
5 SASI_Hs02_00339886 predicted 813
6 SASI_Hs01_00055406 predicted 578
7 SASI_Hs01_00055408 predicted 645
8 SASI_Hs01_00055409 predicted 655
9 SASI_Hs02_00339887 predicted 2388
10 SASI_Hs01_00055410 predicted 1216
11 SASI_Hs01_00055404 predicted 1704
12 SASI_Hs01_00055407 predicted 1416
13 SASI_Hs01_00055411 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339888 predicted 969
2 SASI_Hs01_00180567 predicted 1628
3 SASI_Hs01_00180568 predicted 806
4 SASI_Hs01_00180570 predicted 1178
5 SASI_Hs02_00339889 predicted 700
6 SASI_Hs01_00180571 predicted 469
7 SASI_Hs01_00180573 predicted 544
8 SASI_Hs01_00180574 predicted 546
9 SASI_Hs02_00339890 predicted 2368
10 SASI_Hs01_00180575 predicted 1118
11 SASI_Hs01_00180569 predicted 1590
12 SASI_Hs01_00180572 predicted 1310
13 SASI_Hs01_00180576 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043847 predicted 1124
2 SASI_Rn01_00043848 predicted 327
3 SASI_Rn02_00263089 predicted 685
4 SASI_Rn01_00043849 predicted 1547
5 SASI_Rn01_00043850 predicted 449
6 SASI_Rn01_00043852 predicted 1852
7 SASI_Rn01_00043853 predicted 238
8 SASI_Rn01_00043855 predicted 1156
9 SASI_Rn02_00263090 predicted 1425
10 SASI_Rn01_00043856 predicted 630
11 SASI_Rn01_00043851 predicted 883
12 SASI_Rn01_00043854 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323987 predicted 1595
2 SASI_Mm01_00060074 predicted 1244
3 SASI_Mm01_00060075 predicted 744
4 SASI_Mm01_00060076 predicted 353
5 SASI_Mm01_00060077 predicted 2202
6 SASI_Mm01_00060079 predicted 1277
7 SASI_Mm01_00060080 predicted 2030
8 SASI_Mm01_00060081 predicted 1426
9 SASI_Mm01_00060082 predicted 2002
10 SASI_Mm01_00060083 predicted 1073
11 SASI_Mm01_00060078 predicted 2327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018736
VALIDATED
MRE11A MISSION shRNA Bacterial Glycerol Stock
MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-1217s21c1
Sequence:CCGGTCCGACTACGGGTGGACTATACTCGAGTATAGTCCACCCGTAGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-979s21c1
Sequence:CCGGGTAGGCTTGCTGCGCATTAAACTCGAGTTTAATGCGCAGCAAGCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-220s21c1
Sequence:CCGGGTTAGAGGAAATGATACATTTCTCGAGAAATGTATCATTTCCTCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018736.2-990s1c1
Sequence:CCGGGCGCATTAAAGGGAGAAAGATCTCGAGATCTTTCTCCCTTTAATGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018736.2-602s1c1
Sequence:CCGGCGGTGGAGAAGGTTGACATTACTCGAGTAATGTCAACCTTCTCCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018736.2-2501s1c1
Sequence:CCGGGCTTGTAAGAACTTGGCTAAACTCGAGTTTAGCCAAGTTCTTACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018736.2-1594s1c1
Sequence:CCGGCGCCATATTGATGCTCTGGAACTCGAGTTCCAGAGCATCAATATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018736
VALIDATED
MRE11A MISSION shRNA shRNA Plasmid DNA
MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-1217s21c1
Sequence:CCGGTCCGACTACGGGTGGACTATACTCGAGTATAGTCCACCCGTAGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-979s21c1
Sequence:CCGGGTAGGCTTGCTGCGCATTAAACTCGAGTTTAATGCGCAGCAAGCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-220s21c1
Sequence:CCGGGTTAGAGGAAATGATACATTTCTCGAGAAATGTATCATTTCCTCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018736.2-990s1c1
Sequence:CCGGGCGCATTAAAGGGAGAAAGATCTCGAGATCTTTCTCCCTTTAATGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018736.2-602s1c1
Sequence:CCGGCGGTGGAGAAGGTTGACATTACTCGAGTAATGTCAACCTTCTCCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018736.2-2501s1c1
Sequence:CCGGGCTTGTAAGAACTTGGCTAAACTCGAGTTTAGCCAAGTTCTTACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018736.2-1594s1c1
Sequence:CCGGCGCCATATTGATGCTCTGGAACTCGAGTTCCAGAGCATCAATATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018736
VALIDATED
MRE11A MISSION shRNA Lentiviral Transduction Particles
MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-1217s21c1
Sequence:CCGGTCCGACTACGGGTGGACTATACTCGAGTATAGTCCACCCGTAGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-979s21c1
Sequence:CCGGGTAGGCTTGCTGCGCATTAAACTCGAGTTTAATGCGCAGCAAGCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_018736.2-220s21c1
Sequence:CCGGGTTAGAGGAAATGATACATTTCTCGAGAAATGTATCATTTCCTCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018736.2-990s1c1
Sequence:CCGGGCGCATTAAAGGGAGAAAGATCTCGAGATCTTTCTCCCTTTAATGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018736.2-602s1c1
Sequence:CCGGCGGTGGAGAAGGTTGACATTACTCGAGTAATGTCAACCTTCTCCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018736.2-2501s1c1
Sequence:CCGGGCTTGTAAGAACTTGGCTAAACTCGAGTTTAGCCAAGTTCTTACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018736.2-1594s1c1
Sequence:CCGGCGCCATATTGATGCTCTGGAACTCGAGTTCCAGAGCATCAATATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005591
VALIDATED
MRE11A MISSION shRNA Bacterial Glycerol Stock
MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1038s21c1
Sequence:CCGGTGTTGGTTTGCTGCGTATTAACTCGAGTTAATACGCAGCAAACCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1233s21c1
Sequence:CCGGACGGGAACGTCTGGGTAATTCCTCGAGGAATTACCCAGACGTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1813s21c1
Sequence:CCGGGCTGATGACCTTATGAGTATACTCGAGTATACTCATAAGGTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005591.3-2618s21c1
Sequence:CCGGGTTGAGGGAAAGAGCTTATAACTCGAGTTATAAGCTCTTTCCCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1278s21c1
Sequence:CCGGACGACTGCGAGTGGACTATAGCTCGAGCTATAGTCCACTCGCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005591.2-3710s1c1
Sequence:CCGGGCCCACATCTTTATTGAACTTCTCGAGAAGTTCAATAAAGATGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-1606s1c1
Sequence:CCGGCGATTTCTTAAAGAACGTCATCTCGAGATGACGTTCTTTAAGAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005591.2-598s1c1
Sequence:CCGGGCTGGATTTGTAAATCACTTTCTCGAGAAAGTGATTTACAAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-2132s1c1
Sequence:CCGGCCACTTCAAAGACAGATCAAACTCGAGTTTGATCTGTCTTTGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-1017s1c1
Sequence:CCGGGCTGCGTATTAAAGGGAGGAACTCGAGTTCCTCCCTTTAATACGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005591
VALIDATED
MRE11A MISSION shRNA shRNA Plasmid DNA
MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1038s21c1
Sequence:CCGGTGTTGGTTTGCTGCGTATTAACTCGAGTTAATACGCAGCAAACCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1233s21c1
Sequence:CCGGACGGGAACGTCTGGGTAATTCCTCGAGGAATTACCCAGACGTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1813s21c1
Sequence:CCGGGCTGATGACCTTATGAGTATACTCGAGTATACTCATAAGGTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005591.3-2618s21c1
Sequence:CCGGGTTGAGGGAAAGAGCTTATAACTCGAGTTATAAGCTCTTTCCCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1278s21c1
Sequence:CCGGACGACTGCGAGTGGACTATAGCTCGAGCTATAGTCCACTCGCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005591.2-3710s1c1
Sequence:CCGGGCCCACATCTTTATTGAACTTCTCGAGAAGTTCAATAAAGATGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-1606s1c1
Sequence:CCGGCGATTTCTTAAAGAACGTCATCTCGAGATGACGTTCTTTAAGAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005591.2-598s1c1
Sequence:CCGGGCTGGATTTGTAAATCACTTTCTCGAGAAAGTGATTTACAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-2132s1c1
Sequence:CCGGCCACTTCAAAGACAGATCAAACTCGAGTTTGATCTGTCTTTGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-1017s1c1
Sequence:CCGGGCTGCGTATTAAAGGGAGGAACTCGAGTTCCTCCCTTTAATACGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005591
VALIDATED
MRE11A MISSION shRNA Lentiviral Transduction Particles
MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1038s21c1
Sequence:CCGGTGTTGGTTTGCTGCGTATTAACTCGAGTTAATACGCAGCAAACCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1233s21c1
Sequence:CCGGACGGGAACGTCTGGGTAATTCCTCGAGGAATTACCCAGACGTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1813s21c1
Sequence:CCGGGCTGATGACCTTATGAGTATACTCGAGTATACTCATAAGGTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005591.3-2618s21c1
Sequence:CCGGGTTGAGGGAAAGAGCTTATAACTCGAGTTATAAGCTCTTTCCCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005591.3-1278s21c1
Sequence:CCGGACGACTGCGAGTGGACTATAGCTCGAGCTATAGTCCACTCGCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005591.2-3710s1c1
Sequence:CCGGGCCCACATCTTTATTGAACTTCTCGAGAAGTTCAATAAAGATGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-1606s1c1
Sequence:CCGGCGATTTCTTAAAGAACGTCATCTCGAGATGACGTTCTTTAAGAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005591.2-598s1c1
Sequence:CCGGGCTGGATTTGTAAATCACTTTCTCGAGAAAGTGATTTACAAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-2132s1c1
Sequence:CCGGCCACTTCAAAGACAGATCAAACTCGAGTTTGATCTGTCTTTGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005591.2-1017s1c1
Sequence:CCGGGCTGCGTATTAAAGGGAGGAACTCGAGTTCCTCCCTTTAATACGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)