EMAIL THIS PAGE TO A FRIEND

MREG

melanoregulin

161 Gene Product Result for
Synonyms: DSU WDT2
UniProtKB ID: Q8N565, Q53R89, Q53TC1, Q5XKB6, Q9NWC9, Q9P1S1
Gene ID:
Mouse(381269) melanoregulin
Rat(501162) melanoregulin
chicken(424013) melanoregulin
dog(610230) melanoregulin
cow(613445) melanoregulin
sheep(101108896) melanoregulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018000 Rosetta Predictions human pricing
XM_001056335 Rosetta Predictions rat pricing
XM_576585 Rosetta Predictions rat pricing
NM_001005423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144477 predicted 500
2 SASI_Hs02_00351070 predicted 1022
3 SASI_Hs02_00351071 predicted 1019
4 SASI_Hs01_00144479 predicted 388
5 SASI_Hs01_00144480 predicted 620
6 SASI_Hs01_00144481 predicted 490
7 SASI_Hs01_00144483 predicted 653
8 SASI_Hs02_00351072 predicted 986
9 SASI_Hs01_00144486 predicted 502
10 SASI_Hs02_00351073 predicted 993
11 SASI_Hs01_00144478 predicted 931
12 SASI_Hs01_00144482 predicted 583
13 SASI_Hs01_00144484 predicted 1000
14 SASI_Hs01_00144485 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282950 predicted 550
2 SASI_Rn02_00282951 predicted 408
3 SASI_Rn02_00282952 predicted 488
4 SASI_Rn02_00282953 predicted 430
5 SASI_Rn02_00282954 predicted 648
6 SASI_Rn02_00282955 predicted 264
7 SASI_Rn02_00282956 predicted 525
8 SASI_Rn02_00282957 predicted 448
9 SASI_Rn02_00282958 predicted 287
10 SASI_Rn02_00282959 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405587 predicted 554
2 SASI_Rn02_00405588 predicted 405
3 SASI_Rn02_00405589 predicted 488
4 SASI_Rn02_00405590 predicted 425
5 SASI_Rn02_00405591 predicted 646
6 SASI_Rn02_00405592 predicted 264
7 SASI_Rn02_00405593 predicted 519
8 SASI_Rn02_00405594 predicted 449
9 SASI_Rn02_00405595 predicted 287
10 SASI_Rn02_00405596 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032773 predicted 955
2 SASI_Mm01_00032774 predicted 948
3 SASI_Mm01_00032775 predicted 460
4 SASI_Mm01_00032776 predicted 457
5 SASI_Mm02_00286590 predicted 850
6 SASI_Mm01_00032778 predicted 934
7 SASI_Mm01_00032779 predicted 957
8 SASI_Mm01_00032780 predicted 738
9 SASI_Mm01_00032781 predicted 955
10 SASI_Mm01_00032782 predicted 638
11 SASI_Mm01_00032777 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018000
MREG MISSION shRNA Bacterial Glycerol Stock
melanoregulin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018000.1-522s1c1
Sequence:CCGGGAGTGGCAGAAGCTCAACTATCTCGAGATAGTTGAGCTTCTGCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-373s1c1
Sequence:CCGGCATATTCCTCATTTGGAGCAACTCGAGTTGCTCCAAATGAGGAATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-956s1c1
Sequence:CCGGCCTTCTTCTCTTCAGAAGATACTCGAGTATCTTCTGAAGAGAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-527s1c1
Sequence:CCGGGCAGAAGCTCAACTATGATATCTCGAGATATCATAGTTGAGCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-1338s1c1
Sequence:CCGGGACCAATTTAACTGCTGTGTTCTCGAGAACACAGCAGTTAAATTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-1077s1c1
Sequence:CCGGCAAGAGATCATGGTTCATGTTCTCGAGAACATGAACCATGATCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-491s1c1
Sequence:CCGGCATTCGTAATCAGCAGGCCAACTCGAGTTGGCCTGCTGATTACGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018000.1-1131s1c1
Sequence:CCGGCCATAGATTGCTGAGAACAATCTCGAGATTGTTCTCAGCAATCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-912s1c1
Sequence:CCGGCTTGCACATATGCAGGGAGTACTCGAGTACTCCCTGCATATGTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018000
MREG MISSION shRNA shRNA Plasmid DNA
melanoregulin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018000.1-522s1c1
Sequence:CCGGGAGTGGCAGAAGCTCAACTATCTCGAGATAGTTGAGCTTCTGCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-373s1c1
Sequence:CCGGCATATTCCTCATTTGGAGCAACTCGAGTTGCTCCAAATGAGGAATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-956s1c1
Sequence:CCGGCCTTCTTCTCTTCAGAAGATACTCGAGTATCTTCTGAAGAGAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-527s1c1
Sequence:CCGGGCAGAAGCTCAACTATGATATCTCGAGATATCATAGTTGAGCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-1338s1c1
Sequence:CCGGGACCAATTTAACTGCTGTGTTCTCGAGAACACAGCAGTTAAATTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-1077s1c1
Sequence:CCGGCAAGAGATCATGGTTCATGTTCTCGAGAACATGAACCATGATCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-491s1c1
Sequence:CCGGCATTCGTAATCAGCAGGCCAACTCGAGTTGGCCTGCTGATTACGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018000.1-1131s1c1
Sequence:CCGGCCATAGATTGCTGAGAACAATCTCGAGATTGTTCTCAGCAATCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-912s1c1
Sequence:CCGGCTTGCACATATGCAGGGAGTACTCGAGTACTCCCTGCATATGTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018000
MREG MISSION shRNA Lentiviral Transduction Particles
melanoregulin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018000.1-522s1c1
Sequence:CCGGGAGTGGCAGAAGCTCAACTATCTCGAGATAGTTGAGCTTCTGCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-373s1c1
Sequence:CCGGCATATTCCTCATTTGGAGCAACTCGAGTTGCTCCAAATGAGGAATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-956s1c1
Sequence:CCGGCCTTCTTCTCTTCAGAAGATACTCGAGTATCTTCTGAAGAGAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-527s1c1
Sequence:CCGGGCAGAAGCTCAACTATGATATCTCGAGATATCATAGTTGAGCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-1338s1c1
Sequence:CCGGGACCAATTTAACTGCTGTGTTCTCGAGAACACAGCAGTTAAATTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018000.1-1077s1c1
Sequence:CCGGCAAGAGATCATGGTTCATGTTCTCGAGAACATGAACCATGATCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-491s1c1
Sequence:CCGGCATTCGTAATCAGCAGGCCAACTCGAGTTGGCCTGCTGATTACGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018000.1-1131s1c1
Sequence:CCGGCCATAGATTGCTGAGAACAATCTCGAGATTGTTCTCAGCAATCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018000.1-912s1c1
Sequence:CCGGCTTGCACATATGCAGGGAGTACTCGAGTACTCCCTGCATATGTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005423
VALIDATED
MREG MISSION shRNA Bacterial Glycerol Stock
melanoregulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-520s1c1
Sequence:CCGGGAGACGAATCTTAGAGGACTTCTCGAGAAGTCCTCTAAGATTCGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-287s1c1
Sequence:CCGGGTCAGTGGTAACAATCCGTATCTCGAGATACGGATTGTTACCACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-452s1c1
Sequence:CCGGGAATGGCAAAGACTCAACTATCTCGAGATAGTTGAGTCTTTGCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005423.1-1044s1c1
Sequence:CCGGGCATCGAGAAAGGAAGGCTAACTCGAGTTAGCCTTCCTTTCTCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-562s1c1
Sequence:CCGGCTCTCTGTTGTCAGTGACCAACTCGAGTTGGTCACTGACAACAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005423
VALIDATED
MREG MISSION shRNA shRNA Plasmid DNA
melanoregulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-520s1c1
Sequence:CCGGGAGACGAATCTTAGAGGACTTCTCGAGAAGTCCTCTAAGATTCGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-287s1c1
Sequence:CCGGGTCAGTGGTAACAATCCGTATCTCGAGATACGGATTGTTACCACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-452s1c1
Sequence:CCGGGAATGGCAAAGACTCAACTATCTCGAGATAGTTGAGTCTTTGCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005423.1-1044s1c1
Sequence:CCGGGCATCGAGAAAGGAAGGCTAACTCGAGTTAGCCTTCCTTTCTCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-562s1c1
Sequence:CCGGCTCTCTGTTGTCAGTGACCAACTCGAGTTGGTCACTGACAACAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005423
VALIDATED
MREG MISSION shRNA Lentiviral Transduction Particles
melanoregulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-520s1c1
Sequence:CCGGGAGACGAATCTTAGAGGACTTCTCGAGAAGTCCTCTAAGATTCGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-287s1c1
Sequence:CCGGGTCAGTGGTAACAATCCGTATCTCGAGATACGGATTGTTACCACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-452s1c1
Sequence:CCGGGAATGGCAAAGACTCAACTATCTCGAGATAGTTGAGTCTTTGCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005423.1-1044s1c1
Sequence:CCGGGCATCGAGAAAGGAAGGCTAACTCGAGTTAGCCTTCCTTTCTCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005423.1-562s1c1
Sequence:CCGGCTCTCTGTTGTCAGTGACCAACTCGAGTTGGTCACTGACAACAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)