EMAIL THIS PAGE TO A FRIEND

MRFAP1

Morf4 family associated protein 1

85 Gene Product Result for
Synonyms: PAM14 PGR1
UniProtKB ID: Q9Y605, B3KVT2, D3DVT3
Gene ID:
Human(93621) Summary: This gene encodes an intracellular protein that interacts with members of the MORF4/MRG (mortality factor on chromosome 4/MORF4 related gene) family and the tumor suppressor Rb (retinoblastoma protein.) The protein may play a role in senescence, cell growth and immortalization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(67568) Morf4 family associated protein 1
Rat(282585) Morf4 family associated protein 1
domestic guinea pig(100733737) Morf4 family associated protein 1
naked mole-rat(101713225) Morf4 family associated protein 1
dog(608548) Morf4 family associated protein 1
cow(522338) Morf4 family associated protein 1
domestic cat(101099800) Morf4 family associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033296 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136781 MISSION® esiRNA esiRNA human MRFAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033296 Rosetta Predictions human pricing
NM_001009264 Rosetta Predictions rat pricing
NM_026242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134456 predicted 780
2 SASI_Hs01_00134457 predicted 860
3 SASI_Hs01_00134458 predicted 541
4 SASI_Hs01_00134459 predicted 533
5 SASI_Hs01_00134460 predicted 949
6 SASI_Hs01_00134461 predicted 778
7 SASI_Hs01_00134462 predicted 838
8 SASI_Hs01_00134463 predicted 903
9 SASI_Hs01_00134464 predicted 663
10 SASI_Hs01_00134465 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060320 predicted 961
2 SASI_Rn01_00060321 predicted 222
3 SASI_Rn01_00060324 predicted 777
4 SASI_Rn01_00060325 predicted 805
5 SASI_Rn01_00060326 predicted 505
6 SASI_Rn02_00199502 predicted 790
7 SASI_Rn01_00060327 predicted 533
8 SASI_Rn01_00060328 predicted 194
9 SASI_Rn01_00060329 predicted 887
10 SASI_Rn02_00199503 predicted 834
11 SASI_Rn01_00060322 predicted 938
12 SASI_Rn01_00060323 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155153 predicted 970
2 SASI_Mm01_00155154 predicted 777
3 SASI_Mm01_00155155 predicted 905
4 SASI_Mm01_00155156 predicted 810
5 SASI_Mm02_00329926 predicted 886
6 SASI_Mm01_00155157 predicted 911
7 SASI_Mm01_00155158 predicted 496
8 SASI_Mm01_00155159 predicted 491
9 SASI_Mm01_00155160 predicted 530
10 SASI_Mm01_00155162 predicted 655
11 SASI_Mm01_00155161 predicted 187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026242
VALIDATED
MRFAP1 MISSION shRNA Bacterial Glycerol Stock
Morf4 family associated protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-840s1c1
Sequence:CCGGGCCTTTGGTTGTTGTTCCTAACTCGAGTTAGGAACAACAACCAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-1084s1c1
Sequence:CCGGCGGAGGATAGTATTGTTTCTACTCGAGTAGAAACAATACTATCCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-466s1c1
Sequence:CCGGGATAGAGAAGAGCGAGTCTTCCTCGAGGAAGACTCGCTCTTCTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-842s1c1
Sequence:CCGGCTTTGGTTGTTGTTCCTAAATCTCGAGATTTAGGAACAACAACCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026242
VALIDATED
MRFAP1 MISSION shRNA shRNA Plasmid DNA
Morf4 family associated protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-840s1c1
Sequence:CCGGGCCTTTGGTTGTTGTTCCTAACTCGAGTTAGGAACAACAACCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-1084s1c1
Sequence:CCGGCGGAGGATAGTATTGTTTCTACTCGAGTAGAAACAATACTATCCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-466s1c1
Sequence:CCGGGATAGAGAAGAGCGAGTCTTCCTCGAGGAAGACTCGCTCTTCTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-842s1c1
Sequence:CCGGCTTTGGTTGTTGTTCCTAAATCTCGAGATTTAGGAACAACAACCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026242
VALIDATED
MRFAP1 MISSION shRNA Lentiviral Transduction Particles
Morf4 family associated protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-840s1c1
Sequence:CCGGGCCTTTGGTTGTTGTTCCTAACTCGAGTTAGGAACAACAACCAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-1084s1c1
Sequence:CCGGCGGAGGATAGTATTGTTTCTACTCGAGTAGAAACAATACTATCCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-466s1c1
Sequence:CCGGGATAGAGAAGAGCGAGTCTTCCTCGAGGAAGACTCGCTCTTCTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026242.1-842s1c1
Sequence:CCGGCTTTGGTTGTTGTTCCTAAATCTCGAGATTTAGGAACAACAACCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033296
VALIDATED
MRFAP1 MISSION shRNA Bacterial Glycerol Stock
Morf4 family associated protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-690s1c1
Sequence:CCGGGACCTCAATATGAGTTTCGATCTCGAGATCGAAACTCATATTGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-328s1c1
Sequence:CCGGCAATATGCTCATCCAGATCAACTCGAGTTGATCTGGATGAGCATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-326s1c1
Sequence:CCGGGACAATATGCTCATCCAGATCCTCGAGGATCTGGATGAGCATATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033296.1-320s1c1
Sequence:CCGGGAGATGGACAATATGCTCATCCTCGAGGATGAGCATATTGTCCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-642s1c1
Sequence:CCGGGCTCTGTCTCACTTAACACTACTCGAGTAGTGTTAAGTGAGACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-1065s1c1
Sequence:CCGGGAGCTGGAGAATGGATAGTATCTCGAGATACTATCCATTCTCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-1121s1c1
Sequence:CCGGCCAAAGGAGGAGAGATGTGTTCTCGAGAACACATCTCTCCTCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-1368s1c1
Sequence:CCGGCTGTCTGCATTGGACCCTAAACTCGAGTTTAGGGTCCAATGCAGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-314s1c1
Sequence:CCGGCTGTGGGAGATGGACAATATGCTCGAGCATATTGTCCATCTCCCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-313s1c1
Sequence:CCGGGCTGTGGGAGATGGACAATATCTCGAGATATTGTCCATCTCCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033296
VALIDATED
MRFAP1 MISSION shRNA shRNA Plasmid DNA
Morf4 family associated protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-690s1c1
Sequence:CCGGGACCTCAATATGAGTTTCGATCTCGAGATCGAAACTCATATTGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-328s1c1
Sequence:CCGGCAATATGCTCATCCAGATCAACTCGAGTTGATCTGGATGAGCATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-326s1c1
Sequence:CCGGGACAATATGCTCATCCAGATCCTCGAGGATCTGGATGAGCATATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033296.1-320s1c1
Sequence:CCGGGAGATGGACAATATGCTCATCCTCGAGGATGAGCATATTGTCCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-642s1c1
Sequence:CCGGGCTCTGTCTCACTTAACACTACTCGAGTAGTGTTAAGTGAGACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-1065s1c1
Sequence:CCGGGAGCTGGAGAATGGATAGTATCTCGAGATACTATCCATTCTCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-1121s1c1
Sequence:CCGGCCAAAGGAGGAGAGATGTGTTCTCGAGAACACATCTCTCCTCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-1368s1c1
Sequence:CCGGCTGTCTGCATTGGACCCTAAACTCGAGTTTAGGGTCCAATGCAGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-314s1c1
Sequence:CCGGCTGTGGGAGATGGACAATATGCTCGAGCATATTGTCCATCTCCCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-313s1c1
Sequence:CCGGGCTGTGGGAGATGGACAATATCTCGAGATATTGTCCATCTCCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033296
VALIDATED
MRFAP1 MISSION shRNA Lentiviral Transduction Particles
Morf4 family associated protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-690s1c1
Sequence:CCGGGACCTCAATATGAGTTTCGATCTCGAGATCGAAACTCATATTGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-328s1c1
Sequence:CCGGCAATATGCTCATCCAGATCAACTCGAGTTGATCTGGATGAGCATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-326s1c1
Sequence:CCGGGACAATATGCTCATCCAGATCCTCGAGGATCTGGATGAGCATATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033296.1-320s1c1
Sequence:CCGGGAGATGGACAATATGCTCATCCTCGAGGATGAGCATATTGTCCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-642s1c1
Sequence:CCGGGCTCTGTCTCACTTAACACTACTCGAGTAGTGTTAAGTGAGACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-1065s1c1
Sequence:CCGGGAGCTGGAGAATGGATAGTATCTCGAGATACTATCCATTCTCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-1121s1c1
Sequence:CCGGCCAAAGGAGGAGAGATGTGTTCTCGAGAACACATCTCTCCTCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-1368s1c1
Sequence:CCGGCTGTCTGCATTGGACCCTAAACTCGAGTTTAGGGTCCAATGCAGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033296.1-314s1c1
Sequence:CCGGCTGTGGGAGATGGACAATATGCTCGAGCATATTGTCCATCTCCCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033296.1-313s1c1
Sequence:CCGGGCTGTGGGAGATGGACAATATCTCGAGATATTGTCCATCTCCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)