EMAIL THIS PAGE TO A FRIEND

MRFAP1L1

Morf4 family associated protein 1-like 1

93 Gene Product Result for
Species: Human MRFAP1L1(114932)
UniProtKB ID: Q96HT8, B2R6R0, Q6NXT8, Q9P0J5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152301 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027001 MISSION® esiRNA esiRNA human MRFAP1L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152301 Rosetta Predictions human pricing
NM_203462 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178935 predicted 304
2 SASI_Hs01_00178936 predicted 645
3 SASI_Hs01_00178938 predicted 542
4 SASI_Hs01_00178939 predicted 1021
5 SASI_Hs01_00178940 predicted 1029
6 SASI_Hs01_00178941 predicted 932
7 SASI_Hs01_00178942 predicted 907
8 SASI_Hs02_00365871 predicted 615
9 SASI_Hs01_00178943 predicted 962
10 SASI_Hs02_00365872 predicted 464
11 SASI_Hs01_00178937 predicted 1071
12 SASI_Hs01_00178944 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054095 predicted 1020
2 SASI_Hs01_00054096 predicted 1027
3 SASI_Hs01_00054097 predicted 349
4 SASI_Hs01_00054098 predicted 1037
5 SASI_Hs01_00054099 predicted 1065
6 SASI_Hs01_00054101 predicted 903
7 SASI_Hs01_00054102 predicted 594
8 SASI_Hs02_00373390 predicted 474
9 SASI_Hs01_00054104 predicted 645
10 SASI_Hs02_00373391 predicted 514
11 SASI_Hs01_00054100 predicted 1000
12 SASI_Hs01_00054103 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152301
MRFAP1L1 MISSION shRNA Bacterial Glycerol Stock
Morf4 family associated protein 1-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-504s1c1
Sequence:CCGGGAAAGCCAAGGAGATTGCGAACTCGAGTTCGCAATCTCCTTGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-556s1c1
Sequence:CCGGCGAATAGAGAGAAGCGAGTCTCTCGAGAGACTCGCTTCTCTCTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-381s1c1
Sequence:CCGGCAATATGCTTATCCAGATCAACTCGAGTTGATCTGGATAAGCATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152301.3-1819s1c1
Sequence:CCGGGCAGTTTGAATAGGGACTATTCTCGAGAATAGTCCCTATTCAAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-375s1c1
Sequence:CCGGGATGGACAATATGCTTATCCACTCGAGTGGATAAGCATATTGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152301.3-1601s1c1
Sequence:CCGGGCCTGGTGAAGAATGTATTAACTCGAGTTAATACATTCTTCACCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-557s1c1
Sequence:CCGGGAATAGAGAGAAGCGAGTCTTCTCGAGAAGACTCGCTTCTCTCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-499s1c1
Sequence:CCGGGAGGAGAAAGCCAAGGAGATTCTCGAGAATCTCCTTGGCTTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-307s1c1
Sequence:CCGGGAGGACATCGCGTCTCTTATACTCGAGTATAAGAGACGCGATGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152301
MRFAP1L1 MISSION shRNA shRNA Plasmid DNA
Morf4 family associated protein 1-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-504s1c1
Sequence:CCGGGAAAGCCAAGGAGATTGCGAACTCGAGTTCGCAATCTCCTTGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-556s1c1
Sequence:CCGGCGAATAGAGAGAAGCGAGTCTCTCGAGAGACTCGCTTCTCTCTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-381s1c1
Sequence:CCGGCAATATGCTTATCCAGATCAACTCGAGTTGATCTGGATAAGCATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152301.3-1819s1c1
Sequence:CCGGGCAGTTTGAATAGGGACTATTCTCGAGAATAGTCCCTATTCAAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-375s1c1
Sequence:CCGGGATGGACAATATGCTTATCCACTCGAGTGGATAAGCATATTGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152301.3-1601s1c1
Sequence:CCGGGCCTGGTGAAGAATGTATTAACTCGAGTTAATACATTCTTCACCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-557s1c1
Sequence:CCGGGAATAGAGAGAAGCGAGTCTTCTCGAGAAGACTCGCTTCTCTCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-499s1c1
Sequence:CCGGGAGGAGAAAGCCAAGGAGATTCTCGAGAATCTCCTTGGCTTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-307s1c1
Sequence:CCGGGAGGACATCGCGTCTCTTATACTCGAGTATAAGAGACGCGATGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152301
MRFAP1L1 MISSION shRNA Lentiviral Transduction Particles
Morf4 family associated protein 1-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-504s1c1
Sequence:CCGGGAAAGCCAAGGAGATTGCGAACTCGAGTTCGCAATCTCCTTGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-556s1c1
Sequence:CCGGCGAATAGAGAGAAGCGAGTCTCTCGAGAGACTCGCTTCTCTCTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-381s1c1
Sequence:CCGGCAATATGCTTATCCAGATCAACTCGAGTTGATCTGGATAAGCATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152301.3-1819s1c1
Sequence:CCGGGCAGTTTGAATAGGGACTATTCTCGAGAATAGTCCCTATTCAAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-375s1c1
Sequence:CCGGGATGGACAATATGCTTATCCACTCGAGTGGATAAGCATATTGTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152301.3-1601s1c1
Sequence:CCGGGCCTGGTGAAGAATGTATTAACTCGAGTTAATACATTCTTCACCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-557s1c1
Sequence:CCGGGAATAGAGAGAAGCGAGTCTTCTCGAGAAGACTCGCTTCTCTCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-499s1c1
Sequence:CCGGGAGGAGAAAGCCAAGGAGATTCTCGAGAATCTCCTTGGCTTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152301.3-307s1c1
Sequence:CCGGGAGGACATCGCGTCTCTTATACTCGAGTATAAGAGACGCGATGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)