EMAIL THIS PAGE TO A FRIEND

MRGBP

MRG/MORF4L binding protein

125 Gene Product Result for
Synonyms: C20orf20 Eaf7 MRG15BP URCC4
UniProtKB ID: Q9NV56
Gene ID:
Mouse(73247) MRG/MORF4L binding protein
Rat(311713) MRG/MORF4L binding protein
sheep(101111383) MRG/MORF4L binding protein
domestic guinea pig(100735052) MRG/MORF4L binding protein
naked mole-rat(101706324) MRG/MORF4L binding protein
Zebrafish(393709) MRG/MORF4L binding protein
fruit fly(35880) CG13746 gene product from transcript CG13746-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018270 Rosetta Predictions human pricing
XM_001059141 Rosetta Predictions rat pricing
XM_001074536 Rosetta Predictions rat pricing
NM_028479 Rosetta Predictions mouse pricing
XM_902385 Rosetta Predictions mouse pricing
XM_902395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088834 predicted 300
2 SASI_Hs01_00088835 predicted 873
3 SASI_Hs01_00088836 predicted 214
4 SASI_Hs01_00088838 predicted 1130
5 SASI_Hs01_00088839 predicted 254
6 SASI_Hs01_00088840 predicted 817
7 SASI_Hs01_00088841 predicted 1087
8 SASI_Hs02_00351638 predicted 585
9 SASI_Hs01_00088842 predicted 1057
10 SASI_Hs01_00088843 predicted 228
11 SASI_Hs01_00088837 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292122 predicted 1093
2 SASI_Rn02_00292123 predicted 405
3 SASI_Rn02_00292124 predicted 1218
4 SASI_Rn02_00292125 predicted 537
5 SASI_Rn02_00292126 predicted 424
6 SASI_Rn02_00292127 predicted 994
7 SASI_Rn02_00292128 predicted 410
8 SASI_Rn02_00292129 predicted 396
9 SASI_Rn02_00292130 predicted 1276
10 SASI_Rn02_00292131 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346589 predicted 1311
2 SASI_Rn02_00346590 predicted 1090
3 SASI_Rn02_00346591 predicted 1095
4 SASI_Rn02_00346592 predicted 988
5 SASI_Rn02_00346593 predicted 993
6 SASI_Rn02_00346594 predicted 1274
7 SASI_Rn02_00346595 predicted 810
8 SASI_Rn02_00346596 predicted 1000
9 SASI_Rn02_00346597 predicted 1151
10 SASI_Rn02_00346598 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333929 predicted 607
2 SASI_Mm02_00333930 predicted 610
3 SASI_Mm02_00333931 predicted 731
4 SASI_Mm02_00333932 predicted 616
5 SASI_Mm02_00333933 predicted 602
6 SASI_Mm02_00333934 predicted 753
7 SASI_Mm02_00333935 predicted 642
8 SASI_Mm02_00333936 predicted 606
9 SASI_Mm02_00333937 predicted 914
10 SASI_Mm02_00333938 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265551 predicted 277
2 SASI_Mm01_00265552 predicted 273
3 SASI_Mm01_00265553 predicted 622
4 SASI_Mm01_00265554 predicted 516
5 SASI_Mm01_00265555 predicted 402
6 SASI_Mm01_00265556 predicted 289
7 SASI_Mm01_00265557 predicted 424
8 SASI_Mm01_00265558 predicted 319
9 SASI_Mm01_00265559 predicted 603
10 SASI_Mm01_00265560 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239767 predicted 571
2 SASI_Mm01_00239768 predicted 865
3 SASI_Mm01_00239769 predicted 1211
4 SASI_Mm01_00239770 predicted 967
5 SASI_Mm01_00239771 predicted 1036
6 SASI_Mm01_00239772 predicted 649
7 SASI_Mm01_00239773 predicted 690
8 SASI_Mm01_00239774 predicted 700
9 SASI_Mm01_00239775 predicted 1151
10 SASI_Mm01_00239776 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018270
VALIDATED
MRGBP MISSION shRNA Bacterial Glycerol Stock
MRG/MORF4L binding protein
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-280s21c1
Sequence:CCGGTGAGCACCATGTACGACATGCCTCGAGGCATGTCGTACATGGTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-588s21c1
Sequence:CCGGGACAAAGTCCTGACCGCAAACCTCGAGGTTTGCGGTCAGGACTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-1224s21c1
Sequence:CCGGGAAACTAAGAACTGGATATTTCTCGAGAAATATCCAGTTCTTAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-400s21c1
Sequence:CCGGTGATAGAAGAGGAGATGAAAGCTCGAGCTTTCATCTCCTCTTCTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-398s1c1
Sequence:CCGGGATGATAGAAGAGGAGATGAACTCGAGTTCATCTCCTCTTCTATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018270.3-209s1c1
Sequence:CCGGGATTTGTATTCGGGACAAGTTCTCGAGAACTTGTCCCGAATACAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018270.3-1425s1c1
Sequence:CCGGGCCAGATACAGAGAATTTGTACTCGAGTACAAATTCTCTGTATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-511s1c1
Sequence:CCGGGCAAAGACAAAGAGAAGAACTCTCGAGAGTTCTTCTCTTTGTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-509s1c1
Sequence:CCGGCAGCAAAGACAAAGAGAAGAACTCGAGTTCTTCTCTTTGTCTTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1247s1c1
Sequence:CCGGCCTCATTCACTTGTACTGTAACTCGAGTTACAGTACAAGTGAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-318s1c1
Sequence:CCGGGAGATTCTTCCATTCCCGAATCTCGAGATTCGGGAATGGAAGAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1246s1c1
Sequence:CCGGGCCTCATTCACTTGTACTGTACTCGAGTACAGTACAAGTGAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1030s1c1
Sequence:CCGGCCTCGGATTAGCAAGCAATAACTCGAGTTATTGCTTGCTAATCCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018270.3-203s1c1
Sequence:CCGGCCACATGATTTGTATTCGGGACTCGAGTCCCGAATACAAATCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-191s1c1
Sequence:CCGGGAACCGACACTTCCACATGATCTCGAGATCATGTGGAAGTGTCGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-193s21c1
Sequence:CCGGACCGACACTTCCACATGATTTCTCGAGAAATCATGTGGAAGTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018270
VALIDATED
MRGBP MISSION shRNA shRNA Plasmid DNA
MRG/MORF4L binding protein
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-280s21c1
Sequence:CCGGTGAGCACCATGTACGACATGCCTCGAGGCATGTCGTACATGGTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-588s21c1
Sequence:CCGGGACAAAGTCCTGACCGCAAACCTCGAGGTTTGCGGTCAGGACTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-1224s21c1
Sequence:CCGGGAAACTAAGAACTGGATATTTCTCGAGAAATATCCAGTTCTTAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-400s21c1
Sequence:CCGGTGATAGAAGAGGAGATGAAAGCTCGAGCTTTCATCTCCTCTTCTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-398s1c1
Sequence:CCGGGATGATAGAAGAGGAGATGAACTCGAGTTCATCTCCTCTTCTATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018270.3-209s1c1
Sequence:CCGGGATTTGTATTCGGGACAAGTTCTCGAGAACTTGTCCCGAATACAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018270.3-1425s1c1
Sequence:CCGGGCCAGATACAGAGAATTTGTACTCGAGTACAAATTCTCTGTATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-511s1c1
Sequence:CCGGGCAAAGACAAAGAGAAGAACTCTCGAGAGTTCTTCTCTTTGTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-509s1c1
Sequence:CCGGCAGCAAAGACAAAGAGAAGAACTCGAGTTCTTCTCTTTGTCTTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1247s1c1
Sequence:CCGGCCTCATTCACTTGTACTGTAACTCGAGTTACAGTACAAGTGAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-318s1c1
Sequence:CCGGGAGATTCTTCCATTCCCGAATCTCGAGATTCGGGAATGGAAGAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1246s1c1
Sequence:CCGGGCCTCATTCACTTGTACTGTACTCGAGTACAGTACAAGTGAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1030s1c1
Sequence:CCGGCCTCGGATTAGCAAGCAATAACTCGAGTTATTGCTTGCTAATCCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018270.3-203s1c1
Sequence:CCGGCCACATGATTTGTATTCGGGACTCGAGTCCCGAATACAAATCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-191s1c1
Sequence:CCGGGAACCGACACTTCCACATGATCTCGAGATCATGTGGAAGTGTCGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-193s21c1
Sequence:CCGGACCGACACTTCCACATGATTTCTCGAGAAATCATGTGGAAGTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018270
VALIDATED
MRGBP MISSION shRNA Lentiviral Transduction Particles
MRG/MORF4L binding protein
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-280s21c1
Sequence:CCGGTGAGCACCATGTACGACATGCCTCGAGGCATGTCGTACATGGTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-588s21c1
Sequence:CCGGGACAAAGTCCTGACCGCAAACCTCGAGGTTTGCGGTCAGGACTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-1224s21c1
Sequence:CCGGGAAACTAAGAACTGGATATTTCTCGAGAAATATCCAGTTCTTAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-400s21c1
Sequence:CCGGTGATAGAAGAGGAGATGAAAGCTCGAGCTTTCATCTCCTCTTCTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-398s1c1
Sequence:CCGGGATGATAGAAGAGGAGATGAACTCGAGTTCATCTCCTCTTCTATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018270.3-209s1c1
Sequence:CCGGGATTTGTATTCGGGACAAGTTCTCGAGAACTTGTCCCGAATACAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018270.3-1425s1c1
Sequence:CCGGGCCAGATACAGAGAATTTGTACTCGAGTACAAATTCTCTGTATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-511s1c1
Sequence:CCGGGCAAAGACAAAGAGAAGAACTCTCGAGAGTTCTTCTCTTTGTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-509s1c1
Sequence:CCGGCAGCAAAGACAAAGAGAAGAACTCGAGTTCTTCTCTTTGTCTTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1247s1c1
Sequence:CCGGCCTCATTCACTTGTACTGTAACTCGAGTTACAGTACAAGTGAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-318s1c1
Sequence:CCGGGAGATTCTTCCATTCCCGAATCTCGAGATTCGGGAATGGAAGAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1246s1c1
Sequence:CCGGGCCTCATTCACTTGTACTGTACTCGAGTACAGTACAAGTGAATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-1030s1c1
Sequence:CCGGCCTCGGATTAGCAAGCAATAACTCGAGTTATTGCTTGCTAATCCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018270.3-203s1c1
Sequence:CCGGCCACATGATTTGTATTCGGGACTCGAGTCCCGAATACAAATCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018270.3-191s1c1
Sequence:CCGGGAACCGACACTTCCACATGATCTCGAGATCATGTGGAAGTGTCGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018270.3-193s21c1
Sequence:CCGGACCGACACTTCCACATGATTTCTCGAGAAATCATGTGGAAGTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028479
VALIDATED
MRGBP MISSION shRNA Bacterial Glycerol Stock
MRG/MORF4L binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-586s21c1
Sequence:CCGGATCGGCACTTCCACATGATTTCTCGAGAAATCATGTGGAAGTGCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028479.1-697s21c1
Sequence:CCGGCACTGCACGAGTCTGAGATTCCTCGAGGAATCTCAGACTCGTGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-615s21c1
Sequence:GTACCGGGACAAGTTCAGCCAGAATATTCTCGAGAATATTCTGGCTGAACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-727s21c1
Sequence:CCGGCAAATCCAGAGAGGAACTTTGCTCGAGCAAAGTTCCTCTCTGGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-665s21c1
Sequence:CCGGGGACCATCTGAGCACTATGTACTCGAGTACATAGTGCTCAGATGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028479
VALIDATED
MRGBP MISSION shRNA shRNA Plasmid DNA
MRG/MORF4L binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-586s21c1
Sequence:CCGGATCGGCACTTCCACATGATTTCTCGAGAAATCATGTGGAAGTGCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028479.1-697s21c1
Sequence:CCGGCACTGCACGAGTCTGAGATTCCTCGAGGAATCTCAGACTCGTGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-615s21c1
Sequence:GTACCGGGACAAGTTCAGCCAGAATATTCTCGAGAATATTCTGGCTGAACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-727s21c1
Sequence:CCGGCAAATCCAGAGAGGAACTTTGCTCGAGCAAAGTTCCTCTCTGGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-665s21c1
Sequence:CCGGGGACCATCTGAGCACTATGTACTCGAGTACATAGTGCTCAGATGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028479
VALIDATED
MRGBP MISSION shRNA Lentiviral Transduction Particles
MRG/MORF4L binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-586s21c1
Sequence:CCGGATCGGCACTTCCACATGATTTCTCGAGAAATCATGTGGAAGTGCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028479.1-697s21c1
Sequence:CCGGCACTGCACGAGTCTGAGATTCCTCGAGGAATCTCAGACTCGTGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-615s21c1
Sequence:GTACCGGGACAAGTTCAGCCAGAATATTCTCGAGAATATTCTGGCTGAACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-727s21c1
Sequence:CCGGCAAATCCAGAGAGGAACTTTGCTCGAGCAAAGTTCCTCTCTGGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028479.1-665s21c1
Sequence:CCGGGGACCATCTGAGCACTATGTACTCGAGTACATAGTGCTCAGATGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)