EMAIL THIS PAGE TO A FRIEND

MRGPRD

MAS-related GPR, member D

57 Gene Product Result for
Synonyms: MRGD TGR7
UniProtKB ID: Q8TDS7, Q8NGK7
Gene ID:
Mouse(211578) MAS-related GPR, member D
Rat(293648) MAS-related GPR, member D
sheep(101115243) MAS-related GPR, member D
domestic guinea pig(100715308) MAS-related GPR, member D
naked mole-rat(101711189) MAS-related GPR, member D
cow(615853) MAS-related GPR, member D
dog(483685) MAS-related GPR, member D
domestic cat(101086090) MAS-related GPR, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198923 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_203490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_203490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_203490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198923 Rosetta Predictions human pricing
NM_001001506 Rosetta Predictions rat pricing
XM_579051 Rosetta Predictions rat pricing
NM_203490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030009 predicted 309
2 SASI_Hs01_00030010 predicted 308
3 SASI_Hs01_00030011 predicted 716
4 SASI_Hs01_00030012 predicted 307
5 SASI_Hs01_00030013 predicted 671
6 SASI_Hs01_00030014 predicted 596
7 SASI_Hs01_00030016 predicted 238
8 SASI_Hs01_00030017 predicted 493
9 SASI_Hs01_00030018 predicted 673
10 SASI_Hs02_00372411 predicted 276
11 SASI_Hs01_00030015 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048051 predicted 685
2 SASI_Rn01_00048052 predicted 710
3 SASI_Rn01_00048053 predicted 712
4 SASI_Rn01_00048054 predicted 311
5 SASI_Rn01_00048055 predicted 600
6 SASI_Rn01_00048056 predicted 654
7 SASI_Rn01_00048057 predicted 597
8 SASI_Rn01_00048059 predicted 464
9 SASI_Rn02_00197904 predicted 507
10 SASI_Rn02_00197905 predicted 315
11 SASI_Rn01_00048058 predicted 524
12 SASI_Rn01_00048060 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193693 predicted 715
2 SASI_Rn01_00193694 predicted 724
3 SASI_Rn01_00193695 predicted 656
4 SASI_Rn01_00193696 predicted 600
5 SASI_Rn01_00193697 predicted 665
6 SASI_Rn01_00193698 predicted 467
7 SASI_Rn01_00193699 predicted 529
8 SASI_Rn01_00193700 predicted 511
9 SASI_Rn01_00193701 predicted 522
10 SASI_Rn01_00193702 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143920 predicted 1164
2 SASI_Mm01_00143921 predicted 759
3 SASI_Mm01_00143922 predicted 767
4 SASI_Mm01_00143923 predicted 1577
5 SASI_Mm01_00143924 predicted 1228
6 SASI_Mm01_00143925 predicted 635
7 SASI_Mm01_00143926 predicted 1211
8 SASI_Mm02_00351769 predicted 1543
9 SASI_Mm01_00143927 predicted 765
10 SASI_Mm01_00143928 predicted 1215
11 SASI_Mm01_00143929 predicted 1594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198923
MRGPRD MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-180s21c1
Sequence:CCGGCTTCTGCATCTATATCCTCAACTCGAGTTGAGGATATAGATGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-680s21c1
Sequence:CCGGTCCTGGTGTTCCTCATCTGTTCTCGAGAACAGATGAGGAACACCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-508s21c1
Sequence:CCGGTTCAATGAAGATCGGTGCTTCCTCGAGGAAGCACCGATCTTCATTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-706s1c1
Sequence:CCGGCCTCTGAGCATCTACTGGTTTCTCGAGAAACCAGTAGATGCTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-468s1c1
Sequence:CCGGGAACGGGTTGACCTCTTCCTTCTCGAGAAGGAAGAGGTCAACCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-306s1c1
Sequence:CCGGGAGACTGATGTACTTTGCCTACTCGAGTAGGCAAAGTACATCAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-41s1c1
Sequence:CCGGCCCTAAACTATTCCAGAGGGACTCGAGTCCCTCTGGAATAGTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-450s1c1
Sequence:CCGGGACACTCTGTCTCCTGATGAACTCGAGTTCATCAGGAGACAGAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198923
MRGPRD MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-180s21c1
Sequence:CCGGCTTCTGCATCTATATCCTCAACTCGAGTTGAGGATATAGATGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-680s21c1
Sequence:CCGGTCCTGGTGTTCCTCATCTGTTCTCGAGAACAGATGAGGAACACCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-508s21c1
Sequence:CCGGTTCAATGAAGATCGGTGCTTCCTCGAGGAAGCACCGATCTTCATTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-706s1c1
Sequence:CCGGCCTCTGAGCATCTACTGGTTTCTCGAGAAACCAGTAGATGCTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-468s1c1
Sequence:CCGGGAACGGGTTGACCTCTTCCTTCTCGAGAAGGAAGAGGTCAACCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-306s1c1
Sequence:CCGGGAGACTGATGTACTTTGCCTACTCGAGTAGGCAAAGTACATCAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-41s1c1
Sequence:CCGGCCCTAAACTATTCCAGAGGGACTCGAGTCCCTCTGGAATAGTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-450s1c1
Sequence:CCGGGACACTCTGTCTCCTGATGAACTCGAGTTCATCAGGAGACAGAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198923
MRGPRD MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-180s21c1
Sequence:CCGGCTTCTGCATCTATATCCTCAACTCGAGTTGAGGATATAGATGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-680s21c1
Sequence:CCGGTCCTGGTGTTCCTCATCTGTTCTCGAGAACAGATGAGGAACACCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198923.2-508s21c1
Sequence:CCGGTTCAATGAAGATCGGTGCTTCCTCGAGGAAGCACCGATCTTCATTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-706s1c1
Sequence:CCGGCCTCTGAGCATCTACTGGTTTCTCGAGAAACCAGTAGATGCTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-468s1c1
Sequence:CCGGGAACGGGTTGACCTCTTCCTTCTCGAGAAGGAAGAGGTCAACCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-306s1c1
Sequence:CCGGGAGACTGATGTACTTTGCCTACTCGAGTAGGCAAAGTACATCAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-41s1c1
Sequence:CCGGCCCTAAACTATTCCAGAGGGACTCGAGTCCCTCTGGAATAGTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198923.2-450s1c1
Sequence:CCGGGACACTCTGTCTCCTGATGAACTCGAGTTCATCAGGAGACAGAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203490
MRGPRD MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member D
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-297s1c1
Sequence:CCGGCTATGAAGGGATGAGGAGAATCTCGAGATTCTCCTCATCCCTTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-791s1c1
Sequence:CCGGGCTTCTCTTCGTCTTTGAGCACTCGAGTGCTCAAAGACGAAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-273s1c1
Sequence:CCGGCATAGTCAACATTTCTGCCAACTCGAGTTGGCAGAAATGTTGACTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203490.3-2160s1c1
Sequence:CCGGGCTAAACAGCTTAGCATATTGCTCGAGCAATATGCTAAGCTGTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-427s1c1
Sequence:CCGGCTGTCATCAGTGGTATCTGGTCTCGAGACCAGATACCACTGATGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-266s1c1
Sequence:CCGGCCCTGCTCATAGTCAACATTTCTCGAGAAATGTTGACTATGAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203490
MRGPRD MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member D
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-297s1c1
Sequence:CCGGCTATGAAGGGATGAGGAGAATCTCGAGATTCTCCTCATCCCTTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-791s1c1
Sequence:CCGGGCTTCTCTTCGTCTTTGAGCACTCGAGTGCTCAAAGACGAAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-273s1c1
Sequence:CCGGCATAGTCAACATTTCTGCCAACTCGAGTTGGCAGAAATGTTGACTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203490.3-2160s1c1
Sequence:CCGGGCTAAACAGCTTAGCATATTGCTCGAGCAATATGCTAAGCTGTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-427s1c1
Sequence:CCGGCTGTCATCAGTGGTATCTGGTCTCGAGACCAGATACCACTGATGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-266s1c1
Sequence:CCGGCCCTGCTCATAGTCAACATTTCTCGAGAAATGTTGACTATGAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203490
MRGPRD MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member D
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-297s1c1
Sequence:CCGGCTATGAAGGGATGAGGAGAATCTCGAGATTCTCCTCATCCCTTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-791s1c1
Sequence:CCGGGCTTCTCTTCGTCTTTGAGCACTCGAGTGCTCAAAGACGAAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-273s1c1
Sequence:CCGGCATAGTCAACATTTCTGCCAACTCGAGTTGGCAGAAATGTTGACTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203490.3-2160s1c1
Sequence:CCGGGCTAAACAGCTTAGCATATTGCTCGAGCAATATGCTAAGCTGTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-427s1c1
Sequence:CCGGCTGTCATCAGTGGTATCTGGTCTCGAGACCAGATACCACTGATGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203490.1-266s1c1
Sequence:CCGGCCCTGCTCATAGTCAACATTTCTCGAGAAATGTTGACTATGAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)