EMAIL THIS PAGE TO A FRIEND

MRGPRF

MAS-related GPR, member F

52 Gene Product Result for
Synonyms: GPR140 GPR168 MRGF RTA
UniProtKB ID: Q96AM1, B3KV43, Q8NBK8
Gene ID:
Mouse(211577) MAS-related GPR, member F
Rat(266762) MAS-related GPR, member F
sheep(101122823) MAS-related GPR, member F
domestic guinea pig(100728977) MAS-related GPR, member F
naked mole-rat(101713353) MAS-related GPR, member F
cow(615886) MAS-related GPR, member F
Horse(100049010) MAS-related GPR, member F
dog(483684) MAS-related GPR, member F
domestic cat(101085319) MAS-related GPR, member F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035721 MISSION® esiRNA esiRNA targeting mouse Mrgprf (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153722 Rosetta Predictions rat pricing
XM_579684 Rosetta Predictions rat pricing
NM_145379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269011 predicted 1360
2 SASI_Rn01_00045781 predicted 1485
3 SASI_Rn02_00269012 predicted 1690
4 SASI_Rn02_00269013 predicted 877
5 SASI_Rn01_00045783 predicted 1052
6 SASI_Rn01_00045784 predicted 488
7 SASI_Rn02_00269014 predicted 484
8 SASI_Rn02_00269015 predicted 1105
9 SASI_Rn02_00269016 predicted 1641
10 SASI_Rn02_00269017 predicted 1087
11 SASI_Rn01_00045780 predicted 319
12 SASI_Rn01_00045782 predicted 586
13 SASI_Rn01_00045785 predicted 1051
14 SASI_Rn01_00045786 predicted 1247
15 SASI_Rn01_00045787 predicted 390
16 SASI_Rn01_00045788 predicted 1367
17 SASI_Rn01_00045789 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161973 predicted 585
2 SASI_Rn01_00161974 predicted 652
3 SASI_Rn01_00161975 predicted 583
4 SASI_Rn01_00161976 predicted 755
5 SASI_Rn01_00161977 predicted 583
6 SASI_Rn01_00161978 predicted 591
7 SASI_Rn01_00161979 predicted 805
8 SASI_Rn01_00161980 predicted 644
9 SASI_Rn01_00161981 predicted 651
10 SASI_Rn01_00161982 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080029 predicted 755
2 SASI_Mm01_00080030 predicted 1427
3 SASI_Mm01_00080031 predicted 969
4 SASI_Mm01_00080032 predicted 1417
5 SASI_Mm01_00080034 predicted 230
6 SASI_Mm01_00080035 predicted 1282
7 SASI_Mm02_00340689 predicted 1580
8 SASI_Mm02_00340690 predicted 1374
9 SASI_Mm01_00080038 predicted 556
10 SASI_Mm02_00340691 predicted 547
11 SASI_Mm01_00080033 predicted 1462
12 SASI_Mm01_00080036 predicted 292
13 SASI_Mm01_00080037 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145379
MRGPRF MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member F
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000026283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-193s1c1
Sequence:CCGGGAACAAGATGTGTCCTGGTATCTCGAGATACCAGGACACATCTTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-682s1c1
Sequence:CCGGCCACAATTACTTCTGTATGTTCTCGAGAACATACAGAAGTAATTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145379.1-1431s1c1
Sequence:CCGGCCCTTCTTAACAGAAGCTCAACTCGAGTTGAGCTTCTGTTAAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-976s1c1
Sequence:CCGGCACTGACTTGTGTATCTGCATCTCGAGATGCAGATACACAAGTCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145379
MRGPRF MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member F
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000026283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-193s1c1
Sequence:CCGGGAACAAGATGTGTCCTGGTATCTCGAGATACCAGGACACATCTTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-682s1c1
Sequence:CCGGCCACAATTACTTCTGTATGTTCTCGAGAACATACAGAAGTAATTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145379.1-1431s1c1
Sequence:CCGGCCCTTCTTAACAGAAGCTCAACTCGAGTTGAGCTTCTGTTAAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-976s1c1
Sequence:CCGGCACTGACTTGTGTATCTGCATCTCGAGATGCAGATACACAAGTCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145379
MRGPRF MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member F
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000026283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-193s1c1
Sequence:CCGGGAACAAGATGTGTCCTGGTATCTCGAGATACCAGGACACATCTTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-682s1c1
Sequence:CCGGCCACAATTACTTCTGTATGTTCTCGAGAACATACAGAAGTAATTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145379.1-1431s1c1
Sequence:CCGGCCCTTCTTAACAGAAGCTCAACTCGAGTTGAGCTTCTGTTAAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145379.1-976s1c1
Sequence:CCGGCACTGACTTGTGTATCTGCATCTCGAGATGCAGATACACAAGTCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)