EMAIL THIS PAGE TO A FRIEND

MRGPRG-AS1

MRGPRG antisense RNA 1

42 Gene Product Result for
Synonyms: C11orf36 HSD-40
Species: Human MRGPRG-AS1(283303)
UniProtKB ID: Q2M3A8, Q6TF48, Q8N7R8, Q8N9X7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173590 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173590 Rosetta Predictions human pricing
XR_039843 Rosetta Predictions human pricing
XR_039844 Rosetta Predictions human pricing
XR_039845 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092377 predicted 498
2 SASI_Hs01_00092378 predicted 709
3 SASI_Hs01_00092379 predicted 1043
4 SASI_Hs01_00092380 predicted 487
5 SASI_Hs01_00092381 predicted 1039
6 SASI_Hs01_00092382 predicted 834
7 SASI_Hs01_00092383 predicted 482
8 SASI_Hs01_00092384 predicted 697
9 SASI_Hs01_00092385 predicted 704
10 SASI_Hs01_00092386 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513572 predicted 310
2 SASI_Hs02_00513573 predicted 293
3 SASI_Hs02_00513574 predicted 634
4 SASI_Hs02_00513575 predicted 442
5 SASI_Hs02_00513576 predicted 628
6 SASI_Hs02_00513577 predicted 419
7 SASI_Hs02_00513578 predicted 630
8 SASI_Hs02_00513579 predicted 286
9 SASI_Hs02_00513580 predicted 297
10 SASI_Hs02_00513581 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513582 predicted 305
2 SASI_Hs02_00513583 predicted 291
3 SASI_Hs02_00513584 predicted 628
4 SASI_Hs02_00513585 predicted 446
5 SASI_Hs02_00513586 predicted 632
6 SASI_Hs02_00513587 predicted 421
7 SASI_Hs02_00513588 predicted 636
8 SASI_Hs02_00513589 predicted 281
9 SASI_Hs02_00513590 predicted 295
10 SASI_Hs02_00513591 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513592 predicted 307
2 SASI_Hs02_00513593 predicted 298
3 SASI_Hs02_00513594 predicted 635
4 SASI_Hs02_00513595 predicted 442
5 SASI_Hs02_00513596 predicted 634
6 SASI_Hs02_00513597 predicted 418
7 SASI_Hs02_00513598 predicted 633
8 SASI_Hs02_00513599 predicted 289
9 SASI_Hs02_00513600 predicted 288
10 SASI_Hs02_00513601 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173590
MRGPRG-AS1 MISSION shRNA Bacterial Glycerol Stock
MRGPRG antisense RNA 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1513s1c1
Sequence:CCGGCCTTGGCAGATACAAGGATTTCTCGAGAAATCCTTGTATCTGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-713s1c1
Sequence:CCGGGAGCATCTCTATTAACTTAGTCTCGAGACTAAGTTAATAGAGATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-703s1c1
Sequence:CCGGGTGAAACTTGGAGCATCTCTACTCGAGTAGAGATGCTCCAAGTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1575s1c1
Sequence:CCGGGCAATGACAAGTGTCTCTATACTCGAGTATAGAGACACTTGTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-721s1c1
Sequence:CCGGCTATTAACTTAGTTGGTAGCTCTCGAGAGCTACCAACTAAGTTAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1041s1c1
Sequence:CCGGGCTTTCTATTGGGCACTTCAACTCGAGTTGAAGTGCCCAATAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173590
MRGPRG-AS1 MISSION shRNA shRNA Plasmid DNA
MRGPRG antisense RNA 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1513s1c1
Sequence:CCGGCCTTGGCAGATACAAGGATTTCTCGAGAAATCCTTGTATCTGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-713s1c1
Sequence:CCGGGAGCATCTCTATTAACTTAGTCTCGAGACTAAGTTAATAGAGATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-703s1c1
Sequence:CCGGGTGAAACTTGGAGCATCTCTACTCGAGTAGAGATGCTCCAAGTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1575s1c1
Sequence:CCGGGCAATGACAAGTGTCTCTATACTCGAGTATAGAGACACTTGTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-721s1c1
Sequence:CCGGCTATTAACTTAGTTGGTAGCTCTCGAGAGCTACCAACTAAGTTAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1041s1c1
Sequence:CCGGGCTTTCTATTGGGCACTTCAACTCGAGTTGAAGTGCCCAATAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173590
MRGPRG-AS1 MISSION shRNA Lentiviral Transduction Particles
MRGPRG antisense RNA 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1513s1c1
Sequence:CCGGCCTTGGCAGATACAAGGATTTCTCGAGAAATCCTTGTATCTGCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-713s1c1
Sequence:CCGGGAGCATCTCTATTAACTTAGTCTCGAGACTAAGTTAATAGAGATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-703s1c1
Sequence:CCGGGTGAAACTTGGAGCATCTCTACTCGAGTAGAGATGCTCCAAGTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1575s1c1
Sequence:CCGGGCAATGACAAGTGTCTCTATACTCGAGTATAGAGACACTTGTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173590.1-721s1c1
Sequence:CCGGCTATTAACTTAGTTGGTAGCTCTCGAGAGCTACCAACTAAGTTAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173590.1-1041s1c1
Sequence:CCGGGCTTTCTATTGGGCACTTCAACTCGAGTTGAAGTGCCCAATAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)