EMAIL THIS PAGE TO A FRIEND

MRGPRG

MAS-related GPR, member G

60 Gene Product Result for
Synonyms: GPR169 MRGG
UniProtKB ID: Q86SM5
Gene ID:
Mouse(381974) MAS-related GPR, member G
Rat(309133) MAS-related GPR, member G
domestic cat(101091899) MAS-related GPR, member G
dog(483672) MAS-related GPR, member G
naked mole-rat(101710100) MAS-related GPR, member G
domestic guinea pig(100718668) MAS-related GPR, member G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_203492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_203492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU079801 MISSION® esiRNA esiRNA targeting mouse Mrgprg (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001126608 Rosetta Predictions human pricing
XM_001714419 Rosetta Predictions human pricing
XM_001715064 Rosetta Predictions human pricing
NM_203470 Rosetta Predictions rat pricing
NM_203492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001126608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00383003 predicted 267
2 SASI_Hs02_00383004 predicted 737
3 SASI_Hs02_00383005 predicted 534
4 SASI_Hs02_00383006 predicted 328
5 SASI_Hs02_00383007 predicted 681
6 SASI_Hs02_00383008 predicted 323
7 SASI_Hs02_00383009 predicted 208
8 SASI_Hs02_00383010 predicted 678
9 SASI_Hs02_00383011 predicted 209
10 SASI_Hs02_00383012 predicted 88
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00396992 predicted 247
2 SASI_Hs02_00396993 predicted 718
3 SASI_Hs02_00396994 predicted 513
4 SASI_Hs02_00396995 predicted 307
5 SASI_Hs02_00396996 predicted 616
6 SASI_Hs02_00396997 predicted 315
7 SASI_Hs02_00396998 predicted 667
8 SASI_Hs02_00396999 predicted 226
9 SASI_Hs02_00397000 predicted 621
10 SASI_Hs02_00397001 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401255 predicted 250
2 SASI_Hs02_00401256 predicted 724
3 SASI_Hs02_00401257 predicted 515
4 SASI_Hs02_00401258 predicted 308
5 SASI_Hs02_00401259 predicted 612
6 SASI_Hs02_00401260 predicted 668
7 SASI_Hs02_00401261 predicted 691
8 SASI_Hs02_00401262 predicted 620
9 SASI_Hs02_00401263 predicted 299
10 SASI_Hs02_00401264 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066107 predicted 532
2 SASI_Rn01_00066108 predicted 527
3 SASI_Rn01_00066109 predicted 578
4 SASI_Rn01_00066110 predicted 381
5 SASI_Rn01_00066111 predicted 517
6 SASI_Rn01_00066112 predicted 215
7 SASI_Rn01_00066113 predicted 612
8 SASI_Rn01_00066114 predicted 234
9 SASI_Rn01_00066115 predicted 549
10 SASI_Rn01_00066116 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043661 predicted 1030
2 SASI_Mm01_00043662 predicted 1215
3 SASI_Mm01_00043663 predicted 1078
4 SASI_Mm01_00043664 predicted 688
5 SASI_Mm01_00043665 predicted 1015
6 SASI_Mm01_00043666 predicted 1345
7 SASI_Mm01_00043667 predicted 1133
8 SASI_Mm01_00043668 predicted 288
9 SASI_Mm01_00043669 predicted 1013
10 SASI_Mm01_00043670 predicted 1368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203492
MRGPRG MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member G
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-474s1c1
Sequence:CCGGCAAGTACCATTGGACCAGTGTCTCGAGACACTGGTCCAATGGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-185s1c1
Sequence:CCGGCATGCCAAGTTGGCTTCTCTACTCGAGTAGAGAAGCCAACTTGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-117s1c1
Sequence:CCGGGCACATTAAGAAGGGACCCTTCTCGAGAAGGGTCCCTTCTTAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-619s1c1
Sequence:CCGGCTTCTGTTCTTCTGTCGCCTACTCGAGTAGGCGACAGAAGAACAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-175s1c1
Sequence:CCGGCTCTTCCTCTCATGCCAAGTTCTCGAGAACTTGGCATGAGAGGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-108s1c1
Sequence:CCGGCCTCGGTCTGCACATTAAGAACTCGAGTTCTTAATGTGCAGACCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-533s1c1
Sequence:CCGGCAAGCAAGTTTCTCTTAATCTCTCGAGAGATTAAGAGAAACTTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-357s1c1
Sequence:CCGGCAGGTTCACTTCAGTTGTCCTCTCGAGAGGACAACTGAAGTGAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-225s1c1
Sequence:CCGGCCATGAGGACACACTCTACTTCTCGAGAAGTAGAGTGTGTCCTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203492
MRGPRG MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member G
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-474s1c1
Sequence:CCGGCAAGTACCATTGGACCAGTGTCTCGAGACACTGGTCCAATGGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-185s1c1
Sequence:CCGGCATGCCAAGTTGGCTTCTCTACTCGAGTAGAGAAGCCAACTTGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-117s1c1
Sequence:CCGGGCACATTAAGAAGGGACCCTTCTCGAGAAGGGTCCCTTCTTAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-619s1c1
Sequence:CCGGCTTCTGTTCTTCTGTCGCCTACTCGAGTAGGCGACAGAAGAACAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-175s1c1
Sequence:CCGGCTCTTCCTCTCATGCCAAGTTCTCGAGAACTTGGCATGAGAGGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-108s1c1
Sequence:CCGGCCTCGGTCTGCACATTAAGAACTCGAGTTCTTAATGTGCAGACCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-533s1c1
Sequence:CCGGCAAGCAAGTTTCTCTTAATCTCTCGAGAGATTAAGAGAAACTTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-357s1c1
Sequence:CCGGCAGGTTCACTTCAGTTGTCCTCTCGAGAGGACAACTGAAGTGAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-225s1c1
Sequence:CCGGCCATGAGGACACACTCTACTTCTCGAGAAGTAGAGTGTGTCCTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203492
MRGPRG MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member G
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-474s1c1
Sequence:CCGGCAAGTACCATTGGACCAGTGTCTCGAGACACTGGTCCAATGGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-185s1c1
Sequence:CCGGCATGCCAAGTTGGCTTCTCTACTCGAGTAGAGAAGCCAACTTGGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-117s1c1
Sequence:CCGGGCACATTAAGAAGGGACCCTTCTCGAGAAGGGTCCCTTCTTAATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-619s1c1
Sequence:CCGGCTTCTGTTCTTCTGTCGCCTACTCGAGTAGGCGACAGAAGAACAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-175s1c1
Sequence:CCGGCTCTTCCTCTCATGCCAAGTTCTCGAGAACTTGGCATGAGAGGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203492.1-108s1c1
Sequence:CCGGCCTCGGTCTGCACATTAAGAACTCGAGTTCTTAATGTGCAGACCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-533s1c1
Sequence:CCGGCAAGCAAGTTTCTCTTAATCTCTCGAGAGATTAAGAGAAACTTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-357s1c1
Sequence:CCGGCAGGTTCACTTCAGTTGTCCTCTCGAGAGGACAACTGAAGTGAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203492.1-225s1c1
Sequence:CCGGCCATGAGGACACACTCTACTTCTCGAGAAGTAGAGTGTGTCCTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)