EMAIL THIS PAGE TO A FRIEND

MRGPRX1

MAS-related GPR, member X1

52 Gene Product Result for
Synonyms: GPCR MRGX1 SNSR4
UniProtKB ID: Q96LB2, Q4V9L2, Q8TDD8, Q8TDD9
Gene ID:
Mouse(404242) MAS-related GPR, member X1
Rat(282547) MAS-related GPR, member X1
domestic guinea pig(100726708) MAS-related GPR, member X1
naked mole-rat(101713481) MAS-related GPR, member X1
sheep(101116517) MAS-related GPR, member X1
cow(100296215) MAS-related GPR, member X1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147199 Rosetta Predictions human pricing
NM_172158 Rosetta Predictions rat pricing
NM_207540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036276 predicted 716
2 SASI_Hs01_00036278 predicted 717
3 SASI_Hs01_00036279 predicted 446
4 SASI_Hs01_00036280 predicted 461
5 SASI_Hs01_00036281 predicted 447
6 SASI_Hs01_00036282 predicted 444
7 SASI_Hs01_00036283 predicted 941
8 SASI_Hs01_00036284 predicted 453
9 SASI_Hs02_00365542 predicted 434
10 SASI_Hs02_00365543 predicted 971
11 SASI_Hs01_00036277 predicted 679
12 SASI_Hs01_00036285 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108376 predicted 763
2 SASI_Rn01_00108378 predicted 580
3 SASI_Rn01_00108379 predicted 688
4 SASI_Rn01_00108380 predicted 778
5 SASI_Rn01_00108381 predicted 675
6 SASI_Rn01_00108382 predicted 748
7 SASI_Rn01_00108383 predicted 656
8 SASI_Rn01_00108384 predicted 761
9 SASI_Rn01_00108385 predicted 755
10 SASI_Rn02_00269194 predicted 680
11 SASI_Rn01_00108377 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066050 predicted 564
2 SASI_Mm01_00066051 predicted 685
3 SASI_Mm01_00066054 predicted 570
4 SASI_Mm01_00066047 predicted 818
5 SASI_Mm02_00352091 predicted 437
6 SASI_Mm02_00352092 predicted 663
7 SASI_Mm01_00066056 predicted 580
8 SASI_Mm02_00352093 predicted 273
9 SASI_Mm02_00352094 predicted 435
10 SASI_Mm02_00352095 predicted 444
11 SASI_Mm01_00066048 predicted 899
12 SASI_Mm01_00066049 predicted 944
13 SASI_Mm01_00066052 predicted 862
14 SASI_Mm01_00066053 predicted 435
15 SASI_Mm01_00066055 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207540
MRGPRX1 MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member X1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-636s1c1
Sequence:CCGGCCTCGATTGGTTCTCAGGATTCTCGAGAATCCTGAGAACCAATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-864s1c1
Sequence:CCGGGCTTTACTTGTTCCTGTTATACTCGAGTATAACAGGAACAAGTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-429s1c1
Sequence:CCGGTGGCCTCTATGCCCATAAATTCTCGAGAATTTATGGGCATAGAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-280s1c1
Sequence:CCGGCTGGCAGGAAACACCATTGTACTCGAGTACAATGGTGTTTCCTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-639s1c1
Sequence:CCGGCGATTGGTTCTCAGGATTCCTCTCGAGAGGAATCCTGAGAACCAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207540
MRGPRX1 MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member X1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-636s1c1
Sequence:CCGGCCTCGATTGGTTCTCAGGATTCTCGAGAATCCTGAGAACCAATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-864s1c1
Sequence:CCGGGCTTTACTTGTTCCTGTTATACTCGAGTATAACAGGAACAAGTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-429s1c1
Sequence:CCGGTGGCCTCTATGCCCATAAATTCTCGAGAATTTATGGGCATAGAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-280s1c1
Sequence:CCGGCTGGCAGGAAACACCATTGTACTCGAGTACAATGGTGTTTCCTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-639s1c1
Sequence:CCGGCGATTGGTTCTCAGGATTCCTCTCGAGAGGAATCCTGAGAACCAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207540
MRGPRX1 MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member X1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-636s1c1
Sequence:CCGGCCTCGATTGGTTCTCAGGATTCTCGAGAATCCTGAGAACCAATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-864s1c1
Sequence:CCGGGCTTTACTTGTTCCTGTTATACTCGAGTATAACAGGAACAAGTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-429s1c1
Sequence:CCGGTGGCCTCTATGCCCATAAATTCTCGAGAATTTATGGGCATAGAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-280s1c1
Sequence:CCGGCTGGCAGGAAACACCATTGTACTCGAGTACAATGGTGTTTCCTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207540.1-639s1c1
Sequence:CCGGCGATTGGTTCTCAGGATTCCTCTCGAGAGGAATCCTGAGAACCAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147199
MRGPRX1 MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member X1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-234s1c1
Sequence:CCGGCCGCCTTATATATTCCCTGTTCTCGAGAACAGGGAATATATAAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-511s1c1
Sequence:CCGGGCTTGGTGTCAAACATCAGATCTCGAGATCTGATGTTTGACACCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-729s1c1
Sequence:CCGGCGTGGACAGGGAAGTCTTATTCTCGAGAATAAGACTTCCCTGTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-752s1c1
Sequence:CCGGGTCATGTTCATCTAGTTTCTACTCGAGTAGAAACTAGATGAACATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-291s1c1
Sequence:CCGGCCTCTATCCTGTGATGATGTTCTCGAGAACATCATCACAGGATAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-946s21c1
Sequence:CCGGACGTGGACAGGGAAGTCTTATCTCGAGATAAGACTTCCCTGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-454s21c1
Sequence:CCGGGCCTTATATATTCCCTGTTAACTCGAGTTAACAGGGAATATATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-266s21c1
Sequence:CCGGCGGAACTGAGGAGACTCTTTGCTCGAGCAAAGAGTCTCCTCAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147199
MRGPRX1 MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member X1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-234s1c1
Sequence:CCGGCCGCCTTATATATTCCCTGTTCTCGAGAACAGGGAATATATAAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-511s1c1
Sequence:CCGGGCTTGGTGTCAAACATCAGATCTCGAGATCTGATGTTTGACACCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-729s1c1
Sequence:CCGGCGTGGACAGGGAAGTCTTATTCTCGAGAATAAGACTTCCCTGTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-752s1c1
Sequence:CCGGGTCATGTTCATCTAGTTTCTACTCGAGTAGAAACTAGATGAACATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-291s1c1
Sequence:CCGGCCTCTATCCTGTGATGATGTTCTCGAGAACATCATCACAGGATAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-946s21c1
Sequence:CCGGACGTGGACAGGGAAGTCTTATCTCGAGATAAGACTTCCCTGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-454s21c1
Sequence:CCGGGCCTTATATATTCCCTGTTAACTCGAGTTAACAGGGAATATATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-266s21c1
Sequence:CCGGCGGAACTGAGGAGACTCTTTGCTCGAGCAAAGAGTCTCCTCAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147199
MRGPRX1 MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member X1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-234s1c1
Sequence:CCGGCCGCCTTATATATTCCCTGTTCTCGAGAACAGGGAATATATAAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-511s1c1
Sequence:CCGGGCTTGGTGTCAAACATCAGATCTCGAGATCTGATGTTTGACACCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-729s1c1
Sequence:CCGGCGTGGACAGGGAAGTCTTATTCTCGAGAATAAGACTTCCCTGTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-752s1c1
Sequence:CCGGGTCATGTTCATCTAGTTTCTACTCGAGTAGAAACTAGATGAACATGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147199.1-291s1c1
Sequence:CCGGCCTCTATCCTGTGATGATGTTCTCGAGAACATCATCACAGGATAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-946s21c1
Sequence:CCGGACGTGGACAGGGAAGTCTTATCTCGAGATAAGACTTCCCTGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-454s21c1
Sequence:CCGGGCCTTATATATTCCCTGTTAACTCGAGTTAACAGGGAATATATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147199.3-266s21c1
Sequence:CCGGCGGAACTGAGGAGACTCTTTGCTCGAGCAAAGAGTCTCCTCAGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)