EMAIL THIS PAGE TO A FRIEND

MRGPRX2

MAS-related GPR, member X2

79 Gene Product Result for
Synonyms: MRGX2
Gene ID:
Mouse(243978) MAS-related GPR, member X2
Rat(404640) MAS-related GPR, member X2
dog(485410) MAS-related GPR, member X2
cow(516646) MAS-related GPR, member X2
domestic cat(101097092) MAS-related GPR, member X2
domestic guinea pig(100714611) MAS-related GPR, member X2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054030 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145411 MISSION® esiRNA esiRNA human MRGPRX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054030 Rosetta Predictions human pricing
NM_001002280 Rosetta Predictions rat pricing
NM_001034868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127075 predicted 614
2 SASI_Hs01_00127076 predicted 268
3 SASI_Hs01_00127077 predicted 1508
4 SASI_Hs01_00127078 predicted 625
5 SASI_Hs01_00127079 predicted 563
6 SASI_Hs01_00127080 predicted 885
7 SASI_Hs01_00127081 predicted 355
8 SASI_Hs01_00127082 predicted 392
9 SASI_Hs01_00127083 predicted 224
10 SASI_Hs01_00127084 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110552 predicted 204
2 SASI_Rn01_00110553 predicted 457
3 SASI_Rn01_00110554 predicted 432
4 SASI_Rn01_00110555 predicted 461
5 SASI_Rn01_00110556 predicted 462
6 SASI_Rn01_00110557 predicted 235
7 SASI_Rn01_00110558 predicted 531
8 SASI_Rn01_00110559 predicted 410
9 SASI_Rn01_00110560 predicted 524
10 SASI_Rn01_00110561 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169676 predicted 876
2 SASI_Mm02_00289126 predicted 228
3 SASI_Mm01_00169678 predicted 925
4 SASI_Mm01_00169680 predicted 984
5 SASI_Mm01_00169681 predicted 511
6 SASI_Mm02_00289127 predicted 326
7 SASI_Mm02_00289128 predicted 1151
8 SASI_Mm02_00289129 predicted 138
9 SASI_Mm01_00169675 predicted 1030
10 SASI_Mm01_00169677 predicted 612
11 SASI_Mm01_00169679 predicted 582
12 SASI_Mm01_00169682 predicted 925
13 SASI_Mm01_00169683 predicted 940
14 SASI_Mm01_00169684 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054030
MRGPRX2 MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member X2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054030.2-1093s21c1
Sequence:CCGGCTCTACTTCCATCAGATATATCTCGAGATATATCTGATGGAAGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054030.2-809s21c1
Sequence:CCGGATTCAGTGGTTCCTAATATTACTCGAGTAATATTAGGAACCACTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054030.2-370s21c1
Sequence:CCGGCTGTTCCATCTCCATCAATTTCTCGAGAAATTGATGGAGATGGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054030.2-1191s21c1
Sequence:CCGGAGAGTCCTTGTGAGGATTAAGCTCGAGCTTAATCCTCACAAGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054030.2-1860s1c1
Sequence:CCGGGCTCTCTAATTCGTCCTGGAACTCGAGTTCCAGGACGAATTAGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-820s1c1
Sequence:CCGGCCTAATATTATGGATCTGGAACTCGAGTTCCAGATCCATAATATTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-346s1c1
Sequence:CCGGCCTGGTGTACCTCAGTAACTTCTCGAGAAGTTACTGAGGTACACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-375s1c1
Sequence:CCGGCCATCTCCATCAATTTCCCTACTCGAGTAGGGAAATTGATGGAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-565s1c1
Sequence:CCGGGCTGAGCATCTTGGAAGGGAACTCGAGTTCCCTTCCAAGATGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054030
MRGPRX2 MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member X2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054030.2-1093s21c1
Sequence:CCGGCTCTACTTCCATCAGATATATCTCGAGATATATCTGATGGAAGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054030.2-809s21c1
Sequence:CCGGATTCAGTGGTTCCTAATATTACTCGAGTAATATTAGGAACCACTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054030.2-370s21c1
Sequence:CCGGCTGTTCCATCTCCATCAATTTCTCGAGAAATTGATGGAGATGGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054030.2-1191s21c1
Sequence:CCGGAGAGTCCTTGTGAGGATTAAGCTCGAGCTTAATCCTCACAAGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054030.2-1860s1c1
Sequence:CCGGGCTCTCTAATTCGTCCTGGAACTCGAGTTCCAGGACGAATTAGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-820s1c1
Sequence:CCGGCCTAATATTATGGATCTGGAACTCGAGTTCCAGATCCATAATATTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-346s1c1
Sequence:CCGGCCTGGTGTACCTCAGTAACTTCTCGAGAAGTTACTGAGGTACACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-375s1c1
Sequence:CCGGCCATCTCCATCAATTTCCCTACTCGAGTAGGGAAATTGATGGAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-565s1c1
Sequence:CCGGGCTGAGCATCTTGGAAGGGAACTCGAGTTCCCTTCCAAGATGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054030
MRGPRX2 MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member X2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054030.2-1093s21c1
Sequence:CCGGCTCTACTTCCATCAGATATATCTCGAGATATATCTGATGGAAGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054030.2-809s21c1
Sequence:CCGGATTCAGTGGTTCCTAATATTACTCGAGTAATATTAGGAACCACTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054030.2-370s21c1
Sequence:CCGGCTGTTCCATCTCCATCAATTTCTCGAGAAATTGATGGAGATGGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054030.2-1191s21c1
Sequence:CCGGAGAGTCCTTGTGAGGATTAAGCTCGAGCTTAATCCTCACAAGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054030.2-1860s1c1
Sequence:CCGGGCTCTCTAATTCGTCCTGGAACTCGAGTTCCAGGACGAATTAGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-820s1c1
Sequence:CCGGCCTAATATTATGGATCTGGAACTCGAGTTCCAGATCCATAATATTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-346s1c1
Sequence:CCGGCCTGGTGTACCTCAGTAACTTCTCGAGAAGTTACTGAGGTACACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-375s1c1
Sequence:CCGGCCATCTCCATCAATTTCCCTACTCGAGTAGGGAAATTGATGGAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054030.2-565s1c1
Sequence:CCGGGCTGAGCATCTTGGAAGGGAACTCGAGTTCCCTTCCAAGATGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034868
MRGPRX2 MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member X2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-920s21c1
Sequence:CCGGATATATCCGGTCACAGTATTTCTCGAGAAATACTGTGACCGGATATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034868.3-1879s21c1
Sequence:CCGGGGAGCCCACAGCATCTATTAACTCGAGTTAATAGATGCTGTGGGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-409s21c1
Sequence:GTACCGGCATGATCTTGGACATTGATTCCTCGAGGAATCAATGTCCAAGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-146s21c1
Sequence:CCGGGTGGATTCAAACATAACATACCTCGAGGTATGTTATGTTTGAATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-876s21c1
Sequence:CCGGTCTTAGTGTGGATTGAGAAATCTCGAGATTTCTCAATCCACACTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034868
MRGPRX2 MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member X2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-920s21c1
Sequence:CCGGATATATCCGGTCACAGTATTTCTCGAGAAATACTGTGACCGGATATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034868.3-1879s21c1
Sequence:CCGGGGAGCCCACAGCATCTATTAACTCGAGTTAATAGATGCTGTGGGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-409s21c1
Sequence:GTACCGGCATGATCTTGGACATTGATTCCTCGAGGAATCAATGTCCAAGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-146s21c1
Sequence:CCGGGTGGATTCAAACATAACATACCTCGAGGTATGTTATGTTTGAATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-876s21c1
Sequence:CCGGTCTTAGTGTGGATTGAGAAATCTCGAGATTTCTCAATCCACACTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034868
MRGPRX2 MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member X2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-920s21c1
Sequence:CCGGATATATCCGGTCACAGTATTTCTCGAGAAATACTGTGACCGGATATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034868.3-1879s21c1
Sequence:CCGGGGAGCCCACAGCATCTATTAACTCGAGTTAATAGATGCTGTGGGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-409s21c1
Sequence:GTACCGGCATGATCTTGGACATTGATTCCTCGAGGAATCAATGTCCAAGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-146s21c1
Sequence:CCGGGTGGATTCAAACATAACATACCTCGAGGTATGTTATGTTTGAATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034868.3-876s21c1
Sequence:CCGGTCTTAGTGTGGATTGAGAAATCTCGAGATTTCTCAATCCACACTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)