EMAIL THIS PAGE TO A FRIEND

MRGPRX3

MAS-related GPR, member X3

41 Gene Product Result for
Synonyms: GPCR MRGX3 SNSR1 SNSR2
UniProtKB ID: Q96LB0, B0M0L1, Q8TDE0, Q8TDE1
Gene ID:
Human(117195) Summary: This gene encodes a member of the mas-related/sensory neuron specific subfamily of G protein coupled receptors. The encoded protein may be involved in sensory neuron regulation and in the modulation of pain. [provided by RefSeq, Oct 2009]
Rat(252960) MAS-related GPR, member X3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054031 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105531 MISSION® esiRNA esiRNA human MRGPRX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054031 Rosetta Predictions human pricing
NM_145787 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051608 predicted 858
2 SASI_Hs01_00051610 predicted 1336
3 SASI_Hs01_00051611 predicted 589
4 SASI_Hs01_00051612 predicted 1385
5 SASI_Hs01_00051613 predicted 884
6 SASI_Hs01_00051615 predicted 1374
7 SASI_Hs02_00361973 predicted 588
8 SASI_Hs02_00361974 predicted 1331
9 SASI_Hs01_00051609 predicted 574
10 SASI_Hs02_00361975 predicted 1082
11 SASI_Hs01_00051614 predicted 776
12 SASI_Hs01_00051616 predicted 383
13 SASI_Hs01_00051617 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101313 predicted 799
2 SASI_Rn01_00101314 predicted 859
3 SASI_Rn01_00101315 predicted 751
4 SASI_Rn01_00101316 predicted 728
5 SASI_Rn01_00101317 predicted 869
6 SASI_Rn01_00101318 predicted 826
7 SASI_Rn01_00101319 predicted 532
8 SASI_Rn01_00101320 predicted 253
9 SASI_Rn01_00101321 predicted 792
10 SASI_Rn01_00101322 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054031
MRGPRX3 MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member X3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054031.2-1384s1c1
Sequence:CCGGCCCTTGACAATTATATGCATTCTCGAGAATGCATATAATTGTCAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-1087s1c1
Sequence:CCGGCCACCTGGATTGGAAAGTCTTCTCGAGAAGACTTTCCAATCCAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-580s1c1
Sequence:CCGGCCTCTTCCTTAGCGGCCACATCTCGAGATGTGGCCGCTAAGGAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-675s1c1
Sequence:CCGGCCTACTTTATAGGCCTAAGCACTCGAGTGCTTAGGCCTATAAAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-766s1c1
Sequence:CCGGCAGATACCTGTCATCGGTCATCTCGAGATGACCGATGACAGGTATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054031.2-1439s21c1
Sequence:CCGGGTCCCTCAAGGTCTTCGAATACTCGAGTATTCGAAGACCTTGAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054031.2-1379s21c1
Sequence:CCGGTGCCACCCTTGACAATTATATCTCGAGATATAATTGTCAAGGGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054031.2-582s21c1
Sequence:CCGGTCTTCCTTAGCGGCCACATTACTCGAGTAATGTGGCCGCTAAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054031.2-1089s21c1
Sequence:CCGGACCTGGATTGGAAAGTCTTATCTCGAGATAAGACTTTCCAATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054031
MRGPRX3 MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member X3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054031.2-1384s1c1
Sequence:CCGGCCCTTGACAATTATATGCATTCTCGAGAATGCATATAATTGTCAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-1087s1c1
Sequence:CCGGCCACCTGGATTGGAAAGTCTTCTCGAGAAGACTTTCCAATCCAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-580s1c1
Sequence:CCGGCCTCTTCCTTAGCGGCCACATCTCGAGATGTGGCCGCTAAGGAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-675s1c1
Sequence:CCGGCCTACTTTATAGGCCTAAGCACTCGAGTGCTTAGGCCTATAAAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-766s1c1
Sequence:CCGGCAGATACCTGTCATCGGTCATCTCGAGATGACCGATGACAGGTATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054031.2-1439s21c1
Sequence:CCGGGTCCCTCAAGGTCTTCGAATACTCGAGTATTCGAAGACCTTGAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054031.2-1379s21c1
Sequence:CCGGTGCCACCCTTGACAATTATATCTCGAGATATAATTGTCAAGGGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054031.2-582s21c1
Sequence:CCGGTCTTCCTTAGCGGCCACATTACTCGAGTAATGTGGCCGCTAAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054031.2-1089s21c1
Sequence:CCGGACCTGGATTGGAAAGTCTTATCTCGAGATAAGACTTTCCAATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054031
MRGPRX3 MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member X3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054031.2-1384s1c1
Sequence:CCGGCCCTTGACAATTATATGCATTCTCGAGAATGCATATAATTGTCAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-1087s1c1
Sequence:CCGGCCACCTGGATTGGAAAGTCTTCTCGAGAAGACTTTCCAATCCAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-580s1c1
Sequence:CCGGCCTCTTCCTTAGCGGCCACATCTCGAGATGTGGCCGCTAAGGAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-675s1c1
Sequence:CCGGCCTACTTTATAGGCCTAAGCACTCGAGTGCTTAGGCCTATAAAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054031.2-766s1c1
Sequence:CCGGCAGATACCTGTCATCGGTCATCTCGAGATGACCGATGACAGGTATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054031.2-1439s21c1
Sequence:CCGGGTCCCTCAAGGTCTTCGAATACTCGAGTATTCGAAGACCTTGAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054031.2-1379s21c1
Sequence:CCGGTGCCACCCTTGACAATTATATCTCGAGATATAATTGTCAAGGGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054031.2-582s21c1
Sequence:CCGGTCTTCCTTAGCGGCCACATTACTCGAGTAATGTGGCCGCTAAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054031.2-1089s21c1
Sequence:CCGGACCTGGATTGGAAAGTCTTATCTCGAGATAAGACTTTCCAATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)