EMAIL THIS PAGE TO A FRIEND

MRGPRX4

MAS-related GPR, member X4

20 Gene Product Result for
Synonyms: GPCR MRGX4 SNSR6
Species: Human MRGPRX4(117196)
UniProtKB ID: Q96LA9, Q3KNU3, Q3KNU4, Q502W0, Q8TDD6, Q8TDD7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054032 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109541 MISSION® esiRNA esiRNA human MRGPRX4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054032 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161541 predicted 664
2 SASI_Hs01_00161543 predicted 789
3 SASI_Hs01_00161544 predicted 932
4 SASI_Hs01_00161545 predicted 665
5 SASI_Hs01_00161542 predicted 928
6 SASI_Hs01_00161546 predicted 1148
7 SASI_Hs01_00161547 predicted 1149
8 SASI_Hs01_00161548 predicted 1418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054032
MRGPRX4 MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member X4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-865s21c1
Sequence:CCGGCTGTCCCTGCTGTTTAGTATGCTCGAGCATACTAAACAGCAGGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-1191s21c1
Sequence:CCGGCATGTCCCTGTCCTCTCTAAACTCGAGTTTAGAGAGGACAGGGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-256s1c1
Sequence:CCGGCGCCTCATCAATATCAGCCATCTCGAGATGGCTGATATTGATGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-450s1c1
Sequence:CCGGCCTGCTGTTTAGTATGCTGGACTCGAGTCCAGCATACTAAACAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-655s21c1
Sequence:CCGGCAGATTATACGTTTGCCATTACTCGAGTAATGGCAAACGTATAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-776s1c1
Sequence:CCGGCCCTGTCCTCTCTAAACAGTACTCGAGTACTGTTTAGAGAGGACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-1137s21c1
Sequence:CCGGTTACAGGATGCACCTGAATTTCTCGAGAAATTCAGGTGCATCCTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-234s1c1
Sequence:CCGGCCAGATTATACGTTCGCCATTCTCGAGAATGGCGAACGTATAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-726s1c1
Sequence:CCGGGCACCTGAATTTGGAAGTCTTCTCGAGAAGACTTCCAAATTCAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054032
MRGPRX4 MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member X4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-865s21c1
Sequence:CCGGCTGTCCCTGCTGTTTAGTATGCTCGAGCATACTAAACAGCAGGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-1191s21c1
Sequence:CCGGCATGTCCCTGTCCTCTCTAAACTCGAGTTTAGAGAGGACAGGGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-256s1c1
Sequence:CCGGCGCCTCATCAATATCAGCCATCTCGAGATGGCTGATATTGATGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-450s1c1
Sequence:CCGGCCTGCTGTTTAGTATGCTGGACTCGAGTCCAGCATACTAAACAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-655s21c1
Sequence:CCGGCAGATTATACGTTTGCCATTACTCGAGTAATGGCAAACGTATAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-776s1c1
Sequence:CCGGCCCTGTCCTCTCTAAACAGTACTCGAGTACTGTTTAGAGAGGACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-1137s21c1
Sequence:CCGGTTACAGGATGCACCTGAATTTCTCGAGAAATTCAGGTGCATCCTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-234s1c1
Sequence:CCGGCCAGATTATACGTTCGCCATTCTCGAGAATGGCGAACGTATAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-726s1c1
Sequence:CCGGGCACCTGAATTTGGAAGTCTTCTCGAGAAGACTTCCAAATTCAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054032
MRGPRX4 MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member X4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-865s21c1
Sequence:CCGGCTGTCCCTGCTGTTTAGTATGCTCGAGCATACTAAACAGCAGGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-1191s21c1
Sequence:CCGGCATGTCCCTGTCCTCTCTAAACTCGAGTTTAGAGAGGACAGGGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-256s1c1
Sequence:CCGGCGCCTCATCAATATCAGCCATCTCGAGATGGCTGATATTGATGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-450s1c1
Sequence:CCGGCCTGCTGTTTAGTATGCTGGACTCGAGTCCAGCATACTAAACAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-655s21c1
Sequence:CCGGCAGATTATACGTTTGCCATTACTCGAGTAATGGCAAACGTATAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-776s1c1
Sequence:CCGGCCCTGTCCTCTCTAAACAGTACTCGAGTACTGTTTAGAGAGGACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054032.3-1137s21c1
Sequence:CCGGTTACAGGATGCACCTGAATTTCTCGAGAAATTCAGGTGCATCCTGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-234s1c1
Sequence:CCGGCCAGATTATACGTTCGCCATTCTCGAGAATGGCGAACGTATAATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054032.1-726s1c1
Sequence:CCGGGCACCTGAATTTGGAAGTCTTCTCGAGAAGACTTCCAAATTCAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)