EMAIL THIS PAGE TO A FRIEND

MRI1

methylthioribose-1-phosphate isomerase 1

67 Gene Product Result for
Synonyms: MRDI MTNA Ypr118w
UniProtKB ID: Q9BV20, Q8NDC9
Gene ID:
Mouse(67873) methylthioribose-1-phosphate isomerase homolog (S. cerevisiae)
Rat(288912) methylthioribose-1-phosphate isomerase 1
Zebrafish(100002302) methylthioribose-1-phosphate isomerase homolog (S. cerevisiae)
cow(534734) methylthioribose-1-phosphate isomerase homolog (S. cerevisiae)
domestic cat(101095082) methylthioribose-1-phosphate isomerase homolog (S. cerevisiae)
dog(484914) methylthioribose-1-phosphate isomerase homolog (S. cerevisiae)
sheep(101120663) methylthioribose-1-phosphate isomerase homolog (S. cerevisiae)
domestic guinea pig(100725461) methylthioribose-1-phosphate isomerase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031727 Rosetta Predictions human pricing
NM_032285 Rosetta Predictions human pricing
NM_001010947 Rosetta Predictions rat pricing
NM_026423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178805 predicted 972
2 SASI_Hs01_00178806 predicted 970
3 SASI_Hs01_00178807 predicted 928
4 SASI_Hs01_00178808 predicted 931
5 SASI_Hs01_00178809 predicted 217
6 SASI_Hs01_00178810 predicted 932
7 SASI_Hs01_00178812 predicted 211
8 SASI_Hs02_00307779 predicted 961
9 SASI_Hs02_00307780 predicted 967
10 SASI_Hs01_00178813 predicted 938
11 SASI_Hs01_00178811 predicted 869
12 SASI_Hs01_00178814 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023480 predicted 824
2 SASI_Hs01_00023481 predicted 823
3 SASI_Hs01_00023482 predicted 789
4 SASI_Hs01_00023483 predicted 789
5 SASI_Hs01_00023484 predicted 214
6 SASI_Hs01_00023485 predicted 794
7 SASI_Hs01_00023487 predicted 211
8 SASI_Hs02_00359602 predicted 823
9 SASI_Hs02_00359603 predicted 831
10 SASI_Hs01_00023488 predicted 794
11 SASI_Hs01_00023486 predicted 725
12 SASI_Hs01_00023489 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100946 predicted 375
2 SASI_Rn01_00100948 predicted 783
3 SASI_Rn01_00100949 predicted 529
4 SASI_Rn01_00100951 predicted 403
5 SASI_Rn01_00100952 predicted 466
6 SASI_Rn01_00100953 predicted 804
7 SASI_Rn02_00199824 predicted 524
8 SASI_Rn01_00100954 predicted 976
9 SASI_Rn01_00100955 predicted 510
10 SASI_Rn02_00199825 predicted 890
11 SASI_Rn01_00100947 predicted 446
12 SASI_Rn01_00100950 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064979 predicted 701
2 SASI_Mm01_00064980 predicted 912
3 SASI_Mm01_00064981 predicted 430
4 SASI_Mm02_00330236 predicted 553
5 SASI_Mm01_00064984 predicted 397
6 SASI_Mm01_00064985 predicted 1115
7 SASI_Mm01_00064986 predicted 803
8 SASI_Mm01_00064987 predicted 1231
9 SASI_Mm02_00330237 predicted 1259
10 SASI_Mm02_00330238 predicted 816
11 SASI_Mm01_00064978 predicted 1078
12 SASI_Mm01_00064982 predicted 310
13 SASI_Mm01_00064983 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032285
VALIDATED
MRI1 MISSION shRNA Bacterial Glycerol Stock
methylthioribose-1-phosphate isomerase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-2170s1c1
Sequence:CCGGGAGACCAGTTTGGGTAACATACTCGAGTATGTTACCCAAACTGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-1973s1c1
Sequence:CCGGCGAACTCCTGACTCAAATGATCTCGAGATCATTTGAGTCAGGAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032285.1-796s1c1
Sequence:CCGGGAGATCATTATTGAAGAGCGACTCGAGTCGCTCTTCAATAATGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-1257s1c1
Sequence:CCGGGCCTTGGTTTCCTCATTTATACTCGAGTATAAATGAGGAAACCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-559s21c1
Sequence:CCGGACGGCCTTTGAGCTGGTCTATCTCGAGATAGACCAGCTCAAAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-434s21c1
Sequence:CCGGAGAGACGTGAAACGGAGCTATCTCGAGATAGCTCCGTTTCACGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-456s21c1
Sequence:CCGGCGAGCATTGGGAAGAGCATACCTCGAGGTATGCTCTTCCCAATGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-594s21c1
Sequence:CCGGCACCCTTATCACCGACAGCATCTCGAGATGCTGTCGGTGATAAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-1187s21c1
Sequence:CCGGCCAGGCTGCCCAGATTCAAATCTCGAGATTTGAATCTGGGCAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-832s21c1
Sequence:CCGGCAGGAGCTGACCGATGTTAATCTCGAGATTAACATCGGTCAGCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-795s21c1
Sequence:CCGGGACCGGCAAGGAGATCATTATCTCGAGATAATGATCTCCTTGCCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-918s21c1
Sequence:CCGGCCTCATCACTGGTGGCATCATCTCGAGATGATGCCACCAGTGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-867s21c1
Sequence:CCGGAGCACCTGGGATTGGAGTTTGCTCGAGCAAACTCCAATCCCAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032285
VALIDATED
MRI1 MISSION shRNA shRNA Plasmid DNA
methylthioribose-1-phosphate isomerase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-2170s1c1
Sequence:CCGGGAGACCAGTTTGGGTAACATACTCGAGTATGTTACCCAAACTGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-1973s1c1
Sequence:CCGGCGAACTCCTGACTCAAATGATCTCGAGATCATTTGAGTCAGGAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032285.1-796s1c1
Sequence:CCGGGAGATCATTATTGAAGAGCGACTCGAGTCGCTCTTCAATAATGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-1257s1c1
Sequence:CCGGGCCTTGGTTTCCTCATTTATACTCGAGTATAAATGAGGAAACCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-559s21c1
Sequence:CCGGACGGCCTTTGAGCTGGTCTATCTCGAGATAGACCAGCTCAAAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-434s21c1
Sequence:CCGGAGAGACGTGAAACGGAGCTATCTCGAGATAGCTCCGTTTCACGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-456s21c1
Sequence:CCGGCGAGCATTGGGAAGAGCATACCTCGAGGTATGCTCTTCCCAATGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-594s21c1
Sequence:CCGGCACCCTTATCACCGACAGCATCTCGAGATGCTGTCGGTGATAAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-1187s21c1
Sequence:CCGGCCAGGCTGCCCAGATTCAAATCTCGAGATTTGAATCTGGGCAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-832s21c1
Sequence:CCGGCAGGAGCTGACCGATGTTAATCTCGAGATTAACATCGGTCAGCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-795s21c1
Sequence:CCGGGACCGGCAAGGAGATCATTATCTCGAGATAATGATCTCCTTGCCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-918s21c1
Sequence:CCGGCCTCATCACTGGTGGCATCATCTCGAGATGATGCCACCAGTGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-867s21c1
Sequence:CCGGAGCACCTGGGATTGGAGTTTGCTCGAGCAAACTCCAATCCCAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032285
VALIDATED
MRI1 MISSION shRNA Lentiviral Transduction Particles
methylthioribose-1-phosphate isomerase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-2170s1c1
Sequence:CCGGGAGACCAGTTTGGGTAACATACTCGAGTATGTTACCCAAACTGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-1973s1c1
Sequence:CCGGCGAACTCCTGACTCAAATGATCTCGAGATCATTTGAGTCAGGAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032285.1-796s1c1
Sequence:CCGGGAGATCATTATTGAAGAGCGACTCGAGTCGCTCTTCAATAATGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032285.1-1257s1c1
Sequence:CCGGGCCTTGGTTTCCTCATTTATACTCGAGTATAAATGAGGAAACCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-559s21c1
Sequence:CCGGACGGCCTTTGAGCTGGTCTATCTCGAGATAGACCAGCTCAAAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-434s21c1
Sequence:CCGGAGAGACGTGAAACGGAGCTATCTCGAGATAGCTCCGTTTCACGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-456s21c1
Sequence:CCGGCGAGCATTGGGAAGAGCATACCTCGAGGTATGCTCTTCCCAATGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-594s21c1
Sequence:CCGGCACCCTTATCACCGACAGCATCTCGAGATGCTGTCGGTGATAAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-1187s21c1
Sequence:CCGGCCAGGCTGCCCAGATTCAAATCTCGAGATTTGAATCTGGGCAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-832s21c1
Sequence:CCGGCAGGAGCTGACCGATGTTAATCTCGAGATTAACATCGGTCAGCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-795s21c1
Sequence:CCGGGACCGGCAAGGAGATCATTATCTCGAGATAATGATCTCCTTGCCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032285.2-918s21c1
Sequence:CCGGCCTCATCACTGGTGGCATCATCTCGAGATGATGCCACCAGTGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032285.2-867s21c1
Sequence:CCGGAGCACCTGGGATTGGAGTTTGCTCGAGCAAACTCCAATCCCAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026423
VALIDATED
MRI1 MISSION shRNA Bacterial Glycerol Stock
methylthioribose-1-phosphate isomerase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-974s1c1
Sequence:CCGGCAGGAGCTAACTGACCTGAATCTCGAGATTCAGGTCAGTTAGCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-1025s1c1
Sequence:CCGGGTTTGGAATCCTGCCTTTGATCTCGAGATCAAAGGCAGGATTCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-732s1c1
Sequence:CCGGCTGCAACTCTCATCACTGACACTCGAGTGTCAGTGATGAGAGTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.3-938s1c1
Sequence:CCGGGTGGAAAGGAGATTGTCATAGCTCGAGCTATGACAATCTCCTTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-1079s21c1
Sequence:CCGGTCACTGAACTGGGTGTCTTTGCTCGAGCAAAGACACCCAGTTCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-552s21c1
Sequence:CCGGGACCGTGCTGACCCACTTAAACTCGAGTTTAAGTGGGTCAGCACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-1143s21c1
Sequence:CCGGAGAGGGACAGACCCTAGATAGCTCGAGCTATCTAGGGTCTGTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-593s21c1
Sequence:CCGGCTGGCTATGGTACAGCGTTAGCTCGAGCTAACGCTGTACCATAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026423.3-1859s21c1
Sequence:CCGGTGCTAGAACAAGTCCTATAAACTCGAGTTTATAGGACTTGTTCTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026423
VALIDATED
MRI1 MISSION shRNA shRNA Plasmid DNA
methylthioribose-1-phosphate isomerase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-974s1c1
Sequence:CCGGCAGGAGCTAACTGACCTGAATCTCGAGATTCAGGTCAGTTAGCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-1025s1c1
Sequence:CCGGGTTTGGAATCCTGCCTTTGATCTCGAGATCAAAGGCAGGATTCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-732s1c1
Sequence:CCGGCTGCAACTCTCATCACTGACACTCGAGTGTCAGTGATGAGAGTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.3-938s1c1
Sequence:CCGGGTGGAAAGGAGATTGTCATAGCTCGAGCTATGACAATCTCCTTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-1079s21c1
Sequence:CCGGTCACTGAACTGGGTGTCTTTGCTCGAGCAAAGACACCCAGTTCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-552s21c1
Sequence:CCGGGACCGTGCTGACCCACTTAAACTCGAGTTTAAGTGGGTCAGCACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-1143s21c1
Sequence:CCGGAGAGGGACAGACCCTAGATAGCTCGAGCTATCTAGGGTCTGTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-593s21c1
Sequence:CCGGCTGGCTATGGTACAGCGTTAGCTCGAGCTAACGCTGTACCATAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026423.3-1859s21c1
Sequence:CCGGTGCTAGAACAAGTCCTATAAACTCGAGTTTATAGGACTTGTTCTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026423
VALIDATED
MRI1 MISSION shRNA Lentiviral Transduction Particles
methylthioribose-1-phosphate isomerase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-974s1c1
Sequence:CCGGCAGGAGCTAACTGACCTGAATCTCGAGATTCAGGTCAGTTAGCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-1025s1c1
Sequence:CCGGGTTTGGAATCCTGCCTTTGATCTCGAGATCAAAGGCAGGATTCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.2-732s1c1
Sequence:CCGGCTGCAACTCTCATCACTGACACTCGAGTGTCAGTGATGAGAGTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026423.3-938s1c1
Sequence:CCGGGTGGAAAGGAGATTGTCATAGCTCGAGCTATGACAATCTCCTTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-1079s21c1
Sequence:CCGGTCACTGAACTGGGTGTCTTTGCTCGAGCAAAGACACCCAGTTCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-552s21c1
Sequence:CCGGGACCGTGCTGACCCACTTAAACTCGAGTTTAAGTGGGTCAGCACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-1143s21c1
Sequence:CCGGAGAGGGACAGACCCTAGATAGCTCGAGCTATCTAGGGTCTGTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026423.3-593s21c1
Sequence:CCGGCTGGCTATGGTACAGCGTTAGCTCGAGCTAACGCTGTACCATAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026423.3-1859s21c1
Sequence:CCGGTGCTAGAACAAGTCCTATAAACTCGAGTTTATAGGACTTGTTCTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)