EMAIL THIS PAGE TO A FRIEND

MRM1

mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)

52 Gene Product Result for
UniProtKB ID: Q6IN84, A8K8E2, Q96GK2, Q9H664
Gene ID:
Mouse(217038) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Rat(363661) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Zebrafish(563095) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
chicken(772219) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
dog(610311) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
domestic cat(101087794) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
cow(526282) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
domestic guinea pig(100732290) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
naked mole-rat(101703841) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
sheep(101111204) mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409826 Anti-MRM1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV41014 Anti-MRM1 antibody produced in rabbit affinity isolated antibody rat, human, canine, bovine, rabbit, horse, guinea pig, mouse
western blot pricing
AV41015 Anti-MRM1 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, horse, canine, human, rabbit
immunohistochemistry, western blot pricing
HPA021598 Anti-MRM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024864 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024864 Rosetta Predictions human pricing
NM_001108832 Rosetta Predictions rat pricing
NM_145433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233611 predicted 793
2 SASI_Hs01_00233612 predicted 802
3 SASI_Hs01_00233613 predicted 731
4 SASI_Hs02_00357448 predicted 523
5 SASI_Hs01_00233614 predicted 1100
6 SASI_Hs01_00233615 predicted 1063
7 SASI_Hs01_00233616 predicted 1101
8 SASI_Hs01_00233617 predicted 825
9 SASI_Hs01_00233619 predicted 257
10 SASI_Hs02_00357449 predicted 933
11 SASI_Hs01_00233618 predicted 1183
12 SASI_Hs01_00233620 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242515 predicted 1342
2 SASI_Rn02_00242516 predicted 1184
3 SASI_Rn02_00242517 predicted 629
4 SASI_Rn02_00242518 predicted 1209
5 SASI_Rn02_00242519 predicted 1248
6 SASI_Rn02_00242520 predicted 612
7 SASI_Rn02_00242521 predicted 1150
8 SASI_Rn02_00242522 predicted 647
9 SASI_Rn02_00242523 predicted 665
10 SASI_Rn02_00242524 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090729 predicted 993
2 SASI_Mm01_00090730 predicted 1542
3 SASI_Mm01_00090731 predicted 716
4 SASI_Mm01_00090732 predicted 440
5 SASI_Mm01_00090733 predicted 1006
6 SASI_Mm01_00090734 predicted 633
7 SASI_Mm01_00090735 predicted 1186
8 SASI_Mm02_00340803 predicted 654
9 SASI_Mm01_00090736 predicted 617
10 SASI_Mm01_00090738 predicted 664
11 SASI_Mm01_00090737 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145433
VALIDATED
MRM1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-276s21c1
Sequence:CCGGCAGCGGCTGGAACGTCTATTTCTCGAGAAATAGACGTTCCAGCCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-1028s21c1
Sequence:CCGGTATTCTTCTACACTCCATTTGCTCGAGCAAATGGAGTGTAGAAGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-991s21c1
Sequence:CCGGCTGGTCTTGAGTCCTTGAATGCTCGAGCATTCAAGGACTCAAGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145433.1-1506s21c1
Sequence:CCGGCTGACTGAACAGATGCATATTCTCGAGAATATGCATCTGTTCAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-949s21c1
Sequence:CCGGGCCAGCTGCTCCTTACTATTCCTCGAGGAATAGTAAGGAGCAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145433.1-1053s1c1
Sequence:CCGGCAGAAGAAGGGTTTCCCTGTACTCGAGTACAGGGAAACCCTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145433.1-1021s1c1
Sequence:CCGGCCACAGGTATTCTTCTACACTCTCGAGAGTGTAGAAGAATACCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145433.1-2065s1c1
Sequence:CCGGCCGAGGATAACCTTGAACTTTCTCGAGAAAGTTCAAGGTTATCCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145433.1-2064s1c1
Sequence:CCGGGCCGAGGATAACCTTGAACTTCTCGAGAAGTTCAAGGTTATCCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145433
VALIDATED
MRM1 MISSION shRNA shRNA Plasmid DNA
mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-276s21c1
Sequence:CCGGCAGCGGCTGGAACGTCTATTTCTCGAGAAATAGACGTTCCAGCCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-1028s21c1
Sequence:CCGGTATTCTTCTACACTCCATTTGCTCGAGCAAATGGAGTGTAGAAGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-991s21c1
Sequence:CCGGCTGGTCTTGAGTCCTTGAATGCTCGAGCATTCAAGGACTCAAGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145433.1-1506s21c1
Sequence:CCGGCTGACTGAACAGATGCATATTCTCGAGAATATGCATCTGTTCAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-949s21c1
Sequence:CCGGGCCAGCTGCTCCTTACTATTCCTCGAGGAATAGTAAGGAGCAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145433.1-1053s1c1
Sequence:CCGGCAGAAGAAGGGTTTCCCTGTACTCGAGTACAGGGAAACCCTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145433.1-1021s1c1
Sequence:CCGGCCACAGGTATTCTTCTACACTCTCGAGAGTGTAGAAGAATACCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145433.1-2065s1c1
Sequence:CCGGCCGAGGATAACCTTGAACTTTCTCGAGAAAGTTCAAGGTTATCCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145433.1-2064s1c1
Sequence:CCGGGCCGAGGATAACCTTGAACTTCTCGAGAAGTTCAAGGTTATCCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145433
VALIDATED
MRM1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-276s21c1
Sequence:CCGGCAGCGGCTGGAACGTCTATTTCTCGAGAAATAGACGTTCCAGCCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-1028s21c1
Sequence:CCGGTATTCTTCTACACTCCATTTGCTCGAGCAAATGGAGTGTAGAAGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-991s21c1
Sequence:CCGGCTGGTCTTGAGTCCTTGAATGCTCGAGCATTCAAGGACTCAAGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145433.1-1506s21c1
Sequence:CCGGCTGACTGAACAGATGCATATTCTCGAGAATATGCATCTGTTCAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145433.1-949s21c1
Sequence:CCGGGCCAGCTGCTCCTTACTATTCCTCGAGGAATAGTAAGGAGCAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145433.1-1053s1c1
Sequence:CCGGCAGAAGAAGGGTTTCCCTGTACTCGAGTACAGGGAAACCCTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145433.1-1021s1c1
Sequence:CCGGCCACAGGTATTCTTCTACACTCTCGAGAGTGTAGAAGAATACCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145433.1-2065s1c1
Sequence:CCGGCCGAGGATAACCTTGAACTTTCTCGAGAAAGTTCAAGGTTATCCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145433.1-2064s1c1
Sequence:CCGGGCCGAGGATAACCTTGAACTTCTCGAGAAGTTCAAGGTTATCCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024864
VALIDATED
MRM1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024864.3-713s21c1
Sequence:CCGGACACTTCCTCGGAGTGGATAACTCGAGTTATCCACTCCGAGGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1610s21c1
Sequence:CCGGCGTTCCTCTTGAACCAGTCATCTCGAGATGACTGGTTCAAGAGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1074s21c1
Sequence:CCGGCTTGAGTCCTTGAACGTCTCTCTCGAGAGAGACGTTCAAGGACTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024864.3-825s21c1
Sequence:CCGGACTGATGACCTCACCGGATTTCTCGAGAAATCCGGTGAGGTCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1433s21c1
Sequence:CCGGCAGAGGAAGCTGTTTCCTGTTCTCGAGAACAGGAAACAGCTTCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024864.3-932s1c1
Sequence:CCGGCATCATGAGTTGCTTGGAGTTCTCGAGAACTCCAAGCAACTCATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1433s1c1
Sequence:CCGGCAGAGGAAGCTGTTTCCTGTTCTCGAGAACAGGAAACAGCTTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1074s1c1
Sequence:CCGGCTTGAGTCCTTGAACGTCTCTCTCGAGAGAGACGTTCAAGGACTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1438s1c1
Sequence:CCGGGAAGCTGTTTCCTGTTGTGATCTCGAGATCACAACAGGAAACAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1610s1c1
Sequence:CCGGCGTTCCTCTTGAACCAGTCATCTCGAGATGACTGGTTCAAGAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024864
VALIDATED
MRM1 MISSION shRNA shRNA Plasmid DNA
mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024864.3-713s21c1
Sequence:CCGGACACTTCCTCGGAGTGGATAACTCGAGTTATCCACTCCGAGGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1610s21c1
Sequence:CCGGCGTTCCTCTTGAACCAGTCATCTCGAGATGACTGGTTCAAGAGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1074s21c1
Sequence:CCGGCTTGAGTCCTTGAACGTCTCTCTCGAGAGAGACGTTCAAGGACTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024864.3-825s21c1
Sequence:CCGGACTGATGACCTCACCGGATTTCTCGAGAAATCCGGTGAGGTCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1433s21c1
Sequence:CCGGCAGAGGAAGCTGTTTCCTGTTCTCGAGAACAGGAAACAGCTTCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024864.3-932s1c1
Sequence:CCGGCATCATGAGTTGCTTGGAGTTCTCGAGAACTCCAAGCAACTCATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1433s1c1
Sequence:CCGGCAGAGGAAGCTGTTTCCTGTTCTCGAGAACAGGAAACAGCTTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1074s1c1
Sequence:CCGGCTTGAGTCCTTGAACGTCTCTCTCGAGAGAGACGTTCAAGGACTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1438s1c1
Sequence:CCGGGAAGCTGTTTCCTGTTGTGATCTCGAGATCACAACAGGAAACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1610s1c1
Sequence:CCGGCGTTCCTCTTGAACCAGTCATCTCGAGATGACTGGTTCAAGAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024864
VALIDATED
MRM1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024864.3-713s21c1
Sequence:CCGGACACTTCCTCGGAGTGGATAACTCGAGTTATCCACTCCGAGGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1610s21c1
Sequence:CCGGCGTTCCTCTTGAACCAGTCATCTCGAGATGACTGGTTCAAGAGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1074s21c1
Sequence:CCGGCTTGAGTCCTTGAACGTCTCTCTCGAGAGAGACGTTCAAGGACTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024864.3-825s21c1
Sequence:CCGGACTGATGACCTCACCGGATTTCTCGAGAAATCCGGTGAGGTCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_024864.3-1433s21c1
Sequence:CCGGCAGAGGAAGCTGTTTCCTGTTCTCGAGAACAGGAAACAGCTTCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024864.3-932s1c1
Sequence:CCGGCATCATGAGTTGCTTGGAGTTCTCGAGAACTCCAAGCAACTCATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1433s1c1
Sequence:CCGGCAGAGGAAGCTGTTTCCTGTTCTCGAGAACAGGAAACAGCTTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1074s1c1
Sequence:CCGGCTTGAGTCCTTGAACGTCTCTCTCGAGAGAGACGTTCAAGGACTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1438s1c1
Sequence:CCGGGAAGCTGTTTCCTGTTGTGATCTCGAGATCACAACAGGAAACAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024864.3-1610s1c1
Sequence:CCGGCGTTCCTCTTGAACCAGTCATCTCGAGATGACTGGTTCAAGAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)