EMAIL THIS PAGE TO A FRIEND

MRO

maestro

127 Gene Product Result for
Synonyms: B29 C18orf3
UniProtKB ID: Q9BYG7, B7Z3B2, E9PBI3, Q8N6K5
Gene ID:
Human(83876) Summary: This gene is specifically transcribed in males before and after differentiation of testis, and the encoded protein may play an important role in a mammalian sex determination. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(71263) maestro
Rat(361348) maestro
dog(483979) maestro
cow(524917) maestro
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031939 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127174 Rosetta Predictions human pricing
NM_001127175 Rosetta Predictions human pricing
NM_001127176 Rosetta Predictions human pricing
NM_031939 Rosetta Predictions human pricing
XM_001053368 Rosetta Predictions rat pricing
XM_341629 Rosetta Predictions rat pricing
NM_027741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328537 predicted 757
2 SASI_Hs02_00328538 predicted 760
3 SASI_Hs02_00328539 predicted 756
4 SASI_Hs02_00328540 predicted 797
5 SASI_Hs02_00328541 predicted 681
6 SASI_Hs02_00328542 predicted 360
7 SASI_Hs02_00328543 predicted 621
8 SASI_Hs02_00328544 predicted 641
9 SASI_Hs02_00328545 predicted 892
10 SASI_Hs02_00328546 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328547 predicted 866
2 SASI_Hs02_00328548 predicted 879
3 SASI_Hs02_00328549 predicted 869
4 SASI_Hs02_00328550 predicted 909
5 SASI_Hs02_00328551 predicted 787
6 SASI_Hs02_00328552 predicted 477
7 SASI_Hs02_00328553 predicted 737
8 SASI_Hs02_00328554 predicted 185
9 SASI_Hs02_00328555 predicted 1003
10 SASI_Hs02_00328556 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328557 predicted 1020
2 SASI_Hs02_00328558 predicted 1036
3 SASI_Hs02_00328559 predicted 1026
4 SASI_Hs02_00328560 predicted 1067
5 SASI_Hs02_00328561 predicted 945
6 SASI_Hs02_00328562 predicted 626
7 SASI_Hs02_00328563 predicted 477
8 SASI_Hs02_00328564 predicted 895
9 SASI_Hs02_00328565 predicted 900
10 SASI_Hs02_00328566 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359080 predicted 1127
2 SASI_Hs02_00359081 predicted 1135
3 SASI_Hs02_00359082 predicted 1130
4 SASI_Hs02_00359083 predicted 1163
5 SASI_Hs01_00176570 predicted 1048
6 SASI_Hs01_00176571 predicted 732
7 SASI_Hs01_00176572 predicted 578
8 SASI_Hs01_00176573 predicted 991
9 SASI_Hs02_00359084 predicted 1010
10 SASI_Hs01_00176574 predicted 822
11 SASI_Hs01_00176575 predicted 863
12 SASI_Hs01_00176576 predicted 847
13 SASI_Hs01_00176577 predicted 525
14 SASI_Hs01_00176578 predicted 335
15 SASI_Hs01_00176579 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272114 predicted 351
2 SASI_Rn02_00272115 predicted 1252
3 SASI_Rn02_00272116 predicted 336
4 SASI_Rn02_00272117 predicted 238
5 SASI_Rn02_00272118 predicted 340
6 SASI_Rn02_00272119 predicted 260
7 SASI_Rn02_00272120 predicted 518
8 SASI_Rn02_00272121 predicted 287
9 SASI_Rn02_00272122 predicted 1235
10 SASI_Rn02_00272123 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393179 predicted 300
2 SASI_Rn02_00393180 predicted 351
3 SASI_Rn02_00393181 predicted 345
4 SASI_Rn02_00393182 predicted 115
5 SASI_Rn02_00393183 predicted 179
6 SASI_Rn02_00393184 predicted 167
7 SASI_Rn02_00393185 predicted 110
8 SASI_Rn02_00393186 predicted 202
9 SASI_Rn02_00393187 predicted 224
10 SASI_Rn02_00393188 predicted 3
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179215 predicted 923
2 SASI_Mm01_00179216 predicted 722
3 SASI_Mm01_00179217 predicted 501
4 SASI_Mm01_00179218 predicted 363
5 SASI_Mm01_00179219 predicted 453
6 SASI_Mm01_00179220 predicted 922
7 SASI_Mm01_00179221 predicted 309
8 SASI_Mm01_00179222 predicted 1039
9 SASI_Mm01_00179223 predicted 962
10 SASI_Mm02_00332679 predicted 248
11 SASI_Mm01_00179224 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031939
MRO MISSION shRNA Bacterial Glycerol Stock
maestro
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031939.2-865s1c1
Sequence:CCGGGAATACAGCTTCCAGAGTGAACTCGAGTTCACTCTGGAAGCTGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031939.2-1213s1c1
Sequence:CCGGGCAGGTACACACTTTCTTTAACTCGAGTTAAAGAAAGTGTGTACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-945s1c1
Sequence:CCGGGCAGTTCTTCTACGCAAATAACTCGAGTTATTTGCGTAGAAGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-924s1c1
Sequence:CCGGCCACTATCATCCAGAGATCCTCTCGAGAGGATCTCTGGATGATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031939.2-1756s1c1
Sequence:CCGGGAAAGCTAACACATAGGGAAACTCGAGTTTCCCTATGTGTTAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-771s1c1
Sequence:CCGGCCTCCTGATCCATTTACAGGACTCGAGTCCTGTAAATGGATCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-748s1c1
Sequence:CCGGCAGGTTAAGCAGACACGAGATCTCGAGATCTCGTGTCTGCTTAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031939.3-1473s21c1
Sequence:CCGGGTATTTGCTATTGATACTTTGCTCGAGCAAAGTATCAATAGCAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031939
MRO MISSION shRNA shRNA Plasmid DNA
maestro
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031939.2-865s1c1
Sequence:CCGGGAATACAGCTTCCAGAGTGAACTCGAGTTCACTCTGGAAGCTGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031939.2-1213s1c1
Sequence:CCGGGCAGGTACACACTTTCTTTAACTCGAGTTAAAGAAAGTGTGTACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-945s1c1
Sequence:CCGGGCAGTTCTTCTACGCAAATAACTCGAGTTATTTGCGTAGAAGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-924s1c1
Sequence:CCGGCCACTATCATCCAGAGATCCTCTCGAGAGGATCTCTGGATGATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031939.2-1756s1c1
Sequence:CCGGGAAAGCTAACACATAGGGAAACTCGAGTTTCCCTATGTGTTAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-771s1c1
Sequence:CCGGCCTCCTGATCCATTTACAGGACTCGAGTCCTGTAAATGGATCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-748s1c1
Sequence:CCGGCAGGTTAAGCAGACACGAGATCTCGAGATCTCGTGTCTGCTTAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031939.3-1473s21c1
Sequence:CCGGGTATTTGCTATTGATACTTTGCTCGAGCAAAGTATCAATAGCAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031939
MRO MISSION shRNA Lentiviral Transduction Particles
maestro
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031939.2-865s1c1
Sequence:CCGGGAATACAGCTTCCAGAGTGAACTCGAGTTCACTCTGGAAGCTGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031939.2-1213s1c1
Sequence:CCGGGCAGGTACACACTTTCTTTAACTCGAGTTAAAGAAAGTGTGTACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-945s1c1
Sequence:CCGGGCAGTTCTTCTACGCAAATAACTCGAGTTATTTGCGTAGAAGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-924s1c1
Sequence:CCGGCCACTATCATCCAGAGATCCTCTCGAGAGGATCTCTGGATGATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031939.2-1756s1c1
Sequence:CCGGGAAAGCTAACACATAGGGAAACTCGAGTTTCCCTATGTGTTAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-771s1c1
Sequence:CCGGCCTCCTGATCCATTTACAGGACTCGAGTCCTGTAAATGGATCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031939.2-748s1c1
Sequence:CCGGCAGGTTAAGCAGACACGAGATCTCGAGATCTCGTGTCTGCTTAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031939.3-1473s21c1
Sequence:CCGGGTATTTGCTATTGATACTTTGCTCGAGCAAAGTATCAATAGCAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027741
MRO MISSION shRNA Bacterial Glycerol Stock
maestro
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027741.2-1146s21c1
Sequence:CCGGACTCGCGTGCACACATATATGCTCGAGCATATATGTGTGCACGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-746s21c1
Sequence:CCGGGATTCGCTCTTAGGCCATTTGCTCGAGCAAATGGCCTAAGAGCGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-824s21c1
Sequence:CCGGCCGTATCTGAAACCCAGAAAGCTCGAGCTTTCTGGGTTTCAGATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-509s21c1
Sequence:CCGGCCTGTGAGTTCTGAAGTTATCCTCGAGGATAACTTCAGAACTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-926s21c1
Sequence:CCGGCTGTTCTTCTATGCGAATAAACTCGAGTTTATTCGCATAGAAGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027741
MRO MISSION shRNA shRNA Plasmid DNA
maestro
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027741.2-1146s21c1
Sequence:CCGGACTCGCGTGCACACATATATGCTCGAGCATATATGTGTGCACGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-746s21c1
Sequence:CCGGGATTCGCTCTTAGGCCATTTGCTCGAGCAAATGGCCTAAGAGCGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-824s21c1
Sequence:CCGGCCGTATCTGAAACCCAGAAAGCTCGAGCTTTCTGGGTTTCAGATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-509s21c1
Sequence:CCGGCCTGTGAGTTCTGAAGTTATCCTCGAGGATAACTTCAGAACTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-926s21c1
Sequence:CCGGCTGTTCTTCTATGCGAATAAACTCGAGTTTATTCGCATAGAAGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027741
MRO MISSION shRNA Lentiviral Transduction Particles
maestro
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027741.2-1146s21c1
Sequence:CCGGACTCGCGTGCACACATATATGCTCGAGCATATATGTGTGCACGCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-746s21c1
Sequence:CCGGGATTCGCTCTTAGGCCATTTGCTCGAGCAAATGGCCTAAGAGCGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-824s21c1
Sequence:CCGGCCGTATCTGAAACCCAGAAAGCTCGAGCTTTCTGGGTTTCAGATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-509s21c1
Sequence:CCGGCCTGTGAGTTCTGAAGTTATCCTCGAGGATAACTTCAGAACTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027741.2-926s21c1
Sequence:CCGGCTGTTCTTCTATGCGAATAAACTCGAGTTTATTCGCATAGAAGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)