EMAIL THIS PAGE TO A FRIEND

MROH1

maestro heat-like repeat family member 1

53 Gene Product Result for
Synonyms: HEATR7A
Gene ID:
Mouse(223658) maestro heat-like repeat family member 1
Rat(100125385) maestro heat-like repeat family member 1
Zebrafish(794708) maestro heat-like repeat family member 1
cow(515055) HEAT repeat containing 7A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099280 Rosetta Predictions human pricing
NM_001099281 Rosetta Predictions human pricing
NM_032450 Rosetta Predictions human pricing
NM_001103364 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320367 predicted 1039
2 SASI_Hs02_00320368 predicted 1063
3 SASI_Hs02_00320369 predicted 1036
4 SASI_Hs02_00320370 predicted 515
5 SASI_Hs02_00320371 predicted 532
6 SASI_Hs02_00320372 predicted 652
7 SASI_Hs02_00320373 predicted 889
8 SASI_Hs02_00320374 predicted 882
9 SASI_Hs02_00320375 predicted 877
10 SASI_Hs02_00320376 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320377 predicted 913
2 SASI_Hs02_00320378 predicted 941
3 SASI_Hs02_00320379 predicted 915
4 SASI_Hs02_00320380 predicted 391
5 SASI_Hs02_00320381 predicted 404
6 SASI_Hs02_00320382 predicted 529
7 SASI_Hs02_00320383 predicted 769
8 SASI_Hs02_00320384 predicted 767
9 SASI_Hs02_00320385 predicted 757
10 SASI_Hs02_00320386 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359865 predicted 1036
2 SASI_Hs02_00359866 predicted 1066
3 SASI_Hs02_00359867 predicted 1033
4 SASI_Hs02_00359868 predicted 517
5 SASI_Hs02_00359869 predicted 526
6 SASI_Hs02_00359870 predicted 644
7 SASI_Hs02_00359871 predicted 890
8 SASI_Hs02_00359872 predicted 886
9 SASI_Hs02_00359873 predicted 873
10 SASI_Hs02_00359874 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211626 predicted 623
2 SASI_Rn02_00211627 predicted 1203
3 SASI_Rn02_00211628 predicted 990
4 SASI_Rn02_00211629 predicted 845
5 SASI_Rn02_00211630 predicted 1154
6 SASI_Rn02_00211631 predicted 357
7 SASI_Rn02_00211632 predicted 467
8 SASI_Rn02_00211633 predicted 603
9 SASI_Rn02_00211634 predicted 207
10 SASI_Rn02_00211635 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099280
MROH1 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099280.1-1692s21c1
Sequence:CCGGATGCTTGCTGATCATAGTTTACTCGAGTAAACTATGATCAGCAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-897s21c1
Sequence:CCGGCTTCAGCGCCTACGATGTTCTCTCGAGAGAACATCGTAGGCGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1067s21c1
Sequence:CCGGACGCAGAGACCTTCTACTTGTCTCGAGACAAGTAGAAGGTCTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1379s21c1
Sequence:CCGGGCAGCACTAACACCAGAATAACTCGAGTTATTCTGGTGTTAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1503s21c1
Sequence:CCGGTTGAGTCACCACGGCTGTTACCTCGAGGTAACAGCCGTGGTGACTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099280
MROH1 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099280.1-1692s21c1
Sequence:CCGGATGCTTGCTGATCATAGTTTACTCGAGTAAACTATGATCAGCAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-897s21c1
Sequence:CCGGCTTCAGCGCCTACGATGTTCTCTCGAGAGAACATCGTAGGCGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1067s21c1
Sequence:CCGGACGCAGAGACCTTCTACTTGTCTCGAGACAAGTAGAAGGTCTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1379s21c1
Sequence:CCGGGCAGCACTAACACCAGAATAACTCGAGTTATTCTGGTGTTAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1503s21c1
Sequence:CCGGTTGAGTCACCACGGCTGTTACCTCGAGGTAACAGCCGTGGTGACTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099280
MROH1 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099280.1-1692s21c1
Sequence:CCGGATGCTTGCTGATCATAGTTTACTCGAGTAAACTATGATCAGCAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-897s21c1
Sequence:CCGGCTTCAGCGCCTACGATGTTCTCTCGAGAGAACATCGTAGGCGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1067s21c1
Sequence:CCGGACGCAGAGACCTTCTACTTGTCTCGAGACAAGTAGAAGGTCTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1379s21c1
Sequence:CCGGGCAGCACTAACACCAGAATAACTCGAGTTATTCTGGTGTTAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099280.1-1503s21c1
Sequence:CCGGTTGAGTCACCACGGCTGTTACCTCGAGGTAACAGCCGTGGTGACTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)