EMAIL THIS PAGE TO A FRIEND

MROH2B

maestro heat-like repeat family member 2B

57 Gene Product Result for
Synonyms: HEATR7B2
UniProtKB ID: Q7Z745, Q68DM1, Q7Z4U4, Q8N7X3
Gene ID:
Mouse(223825) maestro heat-like repeat family member 2B
Rat(361902) maestro heat-like repeat family member 2B
domestic guinea pig(100736208) maestro heat-like repeat family member 2B
naked mole-rat(101721245) maestro heat-like repeat family member 2B
cow(518808) maestro heat-like repeat family member 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173489 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001166066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001166066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001166066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124121 MISSION® esiRNA esiRNA human HEATR7B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173489 Rosetta Predictions human pricing
NM_001047908 Rosetta Predictions rat pricing
XM_127913 Rosetta Predictions mouse pricing
XM_904650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247444 predicted 4321
2 SASI_Hs01_00247445 predicted 3343
3 SASI_Hs02_00368254 predicted 3146
4 SASI_Hs01_00247446 predicted 631
5 SASI_Hs01_00247447 predicted 2902
6 SASI_Hs01_00247448 predicted 3616
7 SASI_Hs01_00247452 predicted 3158
8 SASI_Hs01_00247453 predicted 2372
9 SASI_Hs02_00368255 predicted 3857
10 SASI_Hs02_00368256 predicted 2935
11 SASI_Hs01_00247449 predicted 809
12 SASI_Hs01_00247450 predicted 1000
13 SASI_Hs01_00247451 predicted 2435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206695 predicted 938
2 SASI_Rn02_00206696 predicted 1055
3 SASI_Rn02_00206697 predicted 1247
4 SASI_Rn02_00206698 predicted 337
5 SASI_Rn02_00206699 predicted 1522
6 SASI_Rn02_00206700 predicted 1364
7 SASI_Rn02_00206701 predicted 1191
8 SASI_Rn02_00206702 predicted 289
9 SASI_Rn02_00206703 predicted 263
10 SASI_Rn02_00206704 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247025 predicted 1634
2 SASI_Mm01_00247027 predicted 2622
3 SASI_Mm02_00424248 predicted 324
4 SASI_Mm02_00424249 predicted 228
5 SASI_Mm01_00247029 predicted 2223
6 SASI_Mm01_00247030 predicted 1177
7 SASI_Mm01_00247031 predicted 1156
8 SASI_Mm01_00247032 predicted 724
9 SASI_Mm01_00247033 predicted 1717
10 SASI_Mm02_00424250 predicted 350
11 SASI_Mm01_00247026 predicted 2240
12 SASI_Mm01_00247028 predicted 1571
13 SASI_Mm01_00247034 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431063 predicted 4000
2 SASI_Mm02_00431064 predicted 2613
3 SASI_Mm02_00431065 predicted 306
4 SASI_Mm02_00431066 predicted 213
5 SASI_Mm02_00431067 predicted 2752
6 SASI_Mm02_00431068 predicted 4502
7 SASI_Mm02_00431069 predicted 2212
8 SASI_Mm02_00431070 predicted 1135
9 SASI_Mm02_00431071 predicted 709
10 SASI_Mm02_00431072 predicted 1694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173489
MROH2B MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 2B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-3335s21c1
Sequence:CCGGGCGGCTGCTAGCTCAACTATTCTCGAGAATAGTTGAGCTAGCAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-1195s1c1
Sequence:CCGGCCATGTCACTCAGAGCCTAAACTCGAGTTTAGGCTCTGAGTGACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-2177s1c1
Sequence:CCGGCAGTTGCTCAAAGAATCCTTACTCGAGTAAGGATTCTTTGAGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-4618s1c1
Sequence:CCGGGCTGCAAACAAGGACCTTCTTCTCGAGAAGAAGGTCCTTGTTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-2432s1c1
Sequence:CCGGGCCGAGAACCATTTGGATATTCTCGAGAATATCCAAATGGTTCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-5045s1c1
Sequence:CCGGGTTCTCAATTTGACCAGCCAACTCGAGTTGGCTGGTCAAATTGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-3437s1c1
Sequence:CCGGGTCAGTAAGTTCATCCCAAATCTCGAGATTTGGGATGAACTTACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-3111s21c1
Sequence:CCGGAGACCATGATGTGGGATAATGCTCGAGCATTATCCCACATCATGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-5153s21c1
Sequence:CCCGCTTCGTCAAGATCCGTGTATTCTCGAGAATACACGGATCTTGACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-639s21c1
Sequence:CCGGCAATTGTCCAACGATTGATTTCTCGAGAAATCAATCGTTGGACAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173489
MROH2B MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 2B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-3335s21c1
Sequence:CCGGGCGGCTGCTAGCTCAACTATTCTCGAGAATAGTTGAGCTAGCAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-1195s1c1
Sequence:CCGGCCATGTCACTCAGAGCCTAAACTCGAGTTTAGGCTCTGAGTGACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-2177s1c1
Sequence:CCGGCAGTTGCTCAAAGAATCCTTACTCGAGTAAGGATTCTTTGAGCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-4618s1c1
Sequence:CCGGGCTGCAAACAAGGACCTTCTTCTCGAGAAGAAGGTCCTTGTTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-2432s1c1
Sequence:CCGGGCCGAGAACCATTTGGATATTCTCGAGAATATCCAAATGGTTCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-5045s1c1
Sequence:CCGGGTTCTCAATTTGACCAGCCAACTCGAGTTGGCTGGTCAAATTGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-3437s1c1
Sequence:CCGGGTCAGTAAGTTCATCCCAAATCTCGAGATTTGGGATGAACTTACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-3111s21c1
Sequence:CCGGAGACCATGATGTGGGATAATGCTCGAGCATTATCCCACATCATGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-5153s21c1
Sequence:CCCGCTTCGTCAAGATCCGTGTATTCTCGAGAATACACGGATCTTGACGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-639s21c1
Sequence:CCGGCAATTGTCCAACGATTGATTTCTCGAGAAATCAATCGTTGGACAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173489
MROH2B MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 2B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-3335s21c1
Sequence:CCGGGCGGCTGCTAGCTCAACTATTCTCGAGAATAGTTGAGCTAGCAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-1195s1c1
Sequence:CCGGCCATGTCACTCAGAGCCTAAACTCGAGTTTAGGCTCTGAGTGACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-2177s1c1
Sequence:CCGGCAGTTGCTCAAAGAATCCTTACTCGAGTAAGGATTCTTTGAGCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-4618s1c1
Sequence:CCGGGCTGCAAACAAGGACCTTCTTCTCGAGAAGAAGGTCCTTGTTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-2432s1c1
Sequence:CCGGGCCGAGAACCATTTGGATATTCTCGAGAATATCCAAATGGTTCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-5045s1c1
Sequence:CCGGGTTCTCAATTTGACCAGCCAACTCGAGTTGGCTGGTCAAATTGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173489.2-3437s1c1
Sequence:CCGGGTCAGTAAGTTCATCCCAAATCTCGAGATTTGGGATGAACTTACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-3111s21c1
Sequence:CCGGAGACCATGATGTGGGATAATGCTCGAGCATTATCCCACATCATGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-5153s21c1
Sequence:CCCGCTTCGTCAAGATCCGTGTATTCTCGAGAATACACGGATCTTGACGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173489.4-639s21c1
Sequence:CCGGCAATTGTCCAACGATTGATTTCTCGAGAAATCAATCGTTGGACAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001166066
MROH2B MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 2B
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000450003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-1441s21c1
Sequence:CCGGACTCTGTTAAGATCAACTATCCTCGAGGATAGTTGATCTTAACAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-503s21c1
Sequence:CCGGTGAGTAAGGAGGACAACATTACTCGAGTAATGTTGTCCTCCTTACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-1049s21c1
Sequence:CCGGTGCATGCTTTGGCCATAATTACTCGAGTAATTATGGCCAAAGCATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001166066
MROH2B MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 2B
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000450003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-1441s21c1
Sequence:CCGGACTCTGTTAAGATCAACTATCCTCGAGGATAGTTGATCTTAACAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-503s21c1
Sequence:CCGGTGAGTAAGGAGGACAACATTACTCGAGTAATGTTGTCCTCCTTACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-1049s21c1
Sequence:CCGGTGCATGCTTTGGCCATAATTACTCGAGTAATTATGGCCAAAGCATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001166066
MROH2B MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 2B
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000450003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-1441s21c1
Sequence:CCGGACTCTGTTAAGATCAACTATCCTCGAGGATAGTTGATCTTAACAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-503s21c1
Sequence:CCGGTGAGTAAGGAGGACAACATTACTCGAGTAATGTTGTCCTCCTTACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166066.1-1049s21c1
Sequence:CCGGTGCATGCTTTGGCCATAATTACTCGAGTAATTATGGCCAAAGCATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)