EMAIL THIS PAGE TO A FRIEND

MROH5

maestro heat-like repeat family member 5

29 Gene Product Result for
UniProtKB ID: Q6ZUA9
Gene ID:
Mouse(268816) maestro heat-like repeat family member 5
cow(101902147) maestro heat-like repeat family member 5
domestic guinea pig(100722093) maestro heat-like repeat family member 5
naked mole-rat(101716318) maestro heat-like repeat family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207414 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_372060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207414 Rosetta Predictions human pricing
NM_001033365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066137 predicted 2739
2 SASI_Hs02_00374047 predicted 475
3 SASI_Hs01_00066138 predicted 954
4 SASI_Hs01_00066140 predicted 1897
5 SASI_Hs02_00374048 predicted 926
6 SASI_Hs01_00066142 predicted 1536
7 SASI_Hs01_00066143 predicted 947
8 SASI_Hs01_00066144 predicted 387
9 SASI_Hs01_00066145 predicted 2812
10 SASI_Hs01_00066141 predicted 944
11 SASI_Hs01_00066139 predicted 492
12 SASI_Hs01_00066146 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176840 predicted 451
2 SASI_Mm01_00176841 predicted 1528
3 SASI_Mm01_00176842 predicted 355
4 SASI_Mm01_00176843 predicted 511
5 SASI_Mm01_00176844 predicted 467
6 SASI_Mm01_00176845 predicted 1514
7 SASI_Mm01_00176846 predicted 589
8 SASI_Mm01_00176847 predicted 480
9 SASI_Mm01_00176848 predicted 1288
10 SASI_Mm01_00176849 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207414
MROH5 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-2808s1c1
Sequence:CCGGCACCCAGATGCACTATGTCTTCTCGAGAAGACATAGTGCATCTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-2065s1c1
Sequence:CCGGCAGCTCTTGATGTGCCACAAACTCGAGTTTGTGGCACATCAAGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-3141s1c1
Sequence:CCGGCATCCTCATCCTCACCAAGTTCTCGAGAACTTGGTGAGGATGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-1926s1c1
Sequence:CCGGCCTGAACCACAATGGCTACTTCTCGAGAAGTAGCCATTGTGGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-390s1c1
Sequence:CCGGCCACTTGAAGTACATCATCAACTCGAGTTGATGATGTACTTCAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-940s1c1
Sequence:CCGGGCCTTCATGTTTACCTACTATCTCGAGATAGTAGGTAAACATGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-387s1c1
Sequence:CCGGCTTCCACTTGAAGTACATCATCTCGAGATGATGTACTTCAAGTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-2237s1c1
Sequence:CCGGGCTTCCAAGTCATCAAGAATACTCGAGTATTCTTGATGACTTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207414
MROH5 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-2808s1c1
Sequence:CCGGCACCCAGATGCACTATGTCTTCTCGAGAAGACATAGTGCATCTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-2065s1c1
Sequence:CCGGCAGCTCTTGATGTGCCACAAACTCGAGTTTGTGGCACATCAAGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-3141s1c1
Sequence:CCGGCATCCTCATCCTCACCAAGTTCTCGAGAACTTGGTGAGGATGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-1926s1c1
Sequence:CCGGCCTGAACCACAATGGCTACTTCTCGAGAAGTAGCCATTGTGGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-390s1c1
Sequence:CCGGCCACTTGAAGTACATCATCAACTCGAGTTGATGATGTACTTCAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-940s1c1
Sequence:CCGGGCCTTCATGTTTACCTACTATCTCGAGATAGTAGGTAAACATGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-387s1c1
Sequence:CCGGCTTCCACTTGAAGTACATCATCTCGAGATGATGTACTTCAAGTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-2237s1c1
Sequence:CCGGGCTTCCAAGTCATCAAGAATACTCGAGTATTCTTGATGACTTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207414
MROH5 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-2808s1c1
Sequence:CCGGCACCCAGATGCACTATGTCTTCTCGAGAAGACATAGTGCATCTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-2065s1c1
Sequence:CCGGCAGCTCTTGATGTGCCACAAACTCGAGTTTGTGGCACATCAAGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-3141s1c1
Sequence:CCGGCATCCTCATCCTCACCAAGTTCTCGAGAACTTGGTGAGGATGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-1926s1c1
Sequence:CCGGCCTGAACCACAATGGCTACTTCTCGAGAAGTAGCCATTGTGGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-390s1c1
Sequence:CCGGCCACTTGAAGTACATCATCAACTCGAGTTGATGATGTACTTCAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207414.1-940s1c1
Sequence:CCGGGCCTTCATGTTTACCTACTATCTCGAGATAGTAGGTAAACATGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-387s1c1
Sequence:CCGGCTTCCACTTGAAGTACATCATCTCGAGATGATGTACTTCAAGTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207414.1-2237s1c1
Sequence:CCGGGCTTCCAAGTCATCAAGAATACTCGAGTATTCTTGATGACTTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372060
MROH5 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 5
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_372060.1-3636s1c1
Sequence:CCGGGCAGGCCAAGTTCACCTTCTACTCGAGTAGAAGGTGAACTTGGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372060.1-940s1c1
Sequence:CCGGGCCTTCCTGTTTACCTACTATCTCGAGATAGTAGGTAAACAGGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372060
MROH5 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 5
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_372060.1-3636s1c1
Sequence:CCGGGCAGGCCAAGTTCACCTTCTACTCGAGTAGAAGGTGAACTTGGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372060.1-940s1c1
Sequence:CCGGGCCTTCCTGTTTACCTACTATCTCGAGATAGTAGGTAAACAGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372060
MROH5 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 5
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_372060.1-3636s1c1
Sequence:CCGGGCAGGCCAAGTTCACCTTCTACTCGAGTAGAAGGTGAACTTGGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372060.1-940s1c1
Sequence:CCGGGCCTTCCTGTTTACCTACTATCTCGAGATAGTAGGTAAACAGGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033365
MROH5 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-367s21c1
Sequence:CCGGATGTGATGGGAGTCCTAATATCTCGAGATATTAGGACTCCCATCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-229s21c1
Sequence:CCGGCCACGGAACTGAATGATATATCTCGAGATATATCATTCAGTTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033365.2-1767s21c1
Sequence:CCGGCTGCCTGGGTCACTACTATTCCTCGAGGAATAGTAGTGACCCAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-455s21c1
Sequence:CCGGGTTCACCTACTACGGGCTAATCTCGAGATTAGCCCGTAGTAGGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-1444s21c1
Sequence:CCGGACACGGTCCATGATCACTTTGCTCGAGCAAAGTGATCATGGACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033365
MROH5 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-367s21c1
Sequence:CCGGATGTGATGGGAGTCCTAATATCTCGAGATATTAGGACTCCCATCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-229s21c1
Sequence:CCGGCCACGGAACTGAATGATATATCTCGAGATATATCATTCAGTTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033365.2-1767s21c1
Sequence:CCGGCTGCCTGGGTCACTACTATTCCTCGAGGAATAGTAGTGACCCAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-455s21c1
Sequence:CCGGGTTCACCTACTACGGGCTAATCTCGAGATTAGCCCGTAGTAGGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-1444s21c1
Sequence:CCGGACACGGTCCATGATCACTTTGCTCGAGCAAAGTGATCATGGACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033365
MROH5 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-367s21c1
Sequence:CCGGATGTGATGGGAGTCCTAATATCTCGAGATATTAGGACTCCCATCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-229s21c1
Sequence:CCGGCCACGGAACTGAATGATATATCTCGAGATATATCATTCAGTTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033365.2-1767s21c1
Sequence:CCGGCTGCCTGGGTCACTACTATTCCTCGAGGAATAGTAGTGACCCAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-455s21c1
Sequence:CCGGGTTCACCTACTACGGGCTAATCTCGAGATTAGCCCGTAGTAGGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033365.2-1444s21c1
Sequence:CCGGACACGGTCCATGATCACTTTGCTCGAGCAAAGTGATCATGGACCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)